\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117151190:

Variant ID: vg1117151190 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17151190
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


AACCGGTGATCAACCACCGACTGGGAATCAGTCGGCTGAAGCCGAAGCCGGGGTTAATCAGGAGCCCCCGACTGAAAACCAGTCGGACGCAGGGCCAAGC[C/T]
AAGAGATTCCAGAAGTTAGAGCTCAAGCAGACAGCCTTCGCGGACAAGACGCCAGCAATAACCAGAGATCTAGATCTCCTTTAAAGGCATCCGAACCCAC

Reverse complement sequence

GTGGGTTCGGATGCCTTTAAAGGAGATCTAGATCTCTGGTTATTGCTGGCGTCTTGTCCGCGAAGGCTGTCTGCTTGAGCTCTAACTTCTGGAATCTCTT[G/A]
GCTTGGCCCTGCGTCCGACTGGTTTTCAGTCGGGGGCTCCTGATTAACCCCGGCTTCGGCTTCAGCCGACTGATTCCCAGTCGGTGGTTGATCACCGGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 14.30% 0.78% 31.36% NA
All Indica  2759 53.20% 23.90% 0.65% 22.18% NA
All Japonica  1512 60.10% 0.20% 0.93% 38.76% NA
Aus  269 33.50% 1.10% 0.74% 64.68% NA
Indica I  595 33.80% 59.70% 0.34% 6.22% NA
Indica II  465 52.50% 8.60% 0.86% 38.06% NA
Indica III  913 66.90% 9.40% 0.22% 23.44% NA
Indica Intermediate  786 52.50% 22.80% 1.27% 23.41% NA
Temperate Japonica  767 87.20% 0.00% 0.39% 12.39% NA
Tropical Japonica  504 33.70% 0.20% 1.59% 64.48% NA
Japonica Intermediate  241 29.00% 0.80% 1.24% 68.88% NA
VI/Aromatic  96 7.30% 2.10% 1.04% 89.58% NA
Intermediate  90 63.30% 7.80% 2.22% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117151190 C -> T LOC_Os11g29560.1 stop_gained ; p.Gln209*; HIGH stop_gained Average:25.278; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg1117151190 C -> DEL LOC_Os11g29560.1 N frameshift_variant Average:25.278; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117151190 NA 6.28E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117151190 NA 1.97E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117151190 NA 8.78E-07 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117151190 NA 1.19E-07 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117151190 5.51E-06 NA mr1229 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117151190 NA 1.69E-06 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117151190 NA 5.25E-06 mr1298 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117151190 NA 2.07E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117151190 NA 1.52E-07 mr1378 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117151190 NA 6.43E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117151190 NA 2.43E-07 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117151190 NA 1.56E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117151190 NA 3.82E-06 mr1637 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117151190 NA 4.65E-06 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117151190 NA 2.15E-07 mr1751 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117151190 NA 5.31E-08 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117151190 NA 9.11E-06 mr1928 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117151190 NA 4.95E-09 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117151190 NA 1.76E-07 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251