\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117147805:

Variant ID: vg1117147805 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17147805
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.05, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCTCGTAGCAGTGTACCCCAATACCCTCTATATCCGGTCTACGGGTATCCACCATCGACAATGCGGTCCTTTCTCCTGCCTGAAAAAACTACTTTTGG[T/C]
TGTCTAGGAAAACAATTTTCCTAGTAGTGAATCCAATGCAATGCGTTCTGATATGTTTGGCGACATTCTCATCTCTTTTTTTCCCTTCACCTCCACTAAA

Reverse complement sequence

TTTAGTGGAGGTGAAGGGAAAAAAAGAGATGAGAATGTCGCCAAACATATCAGAACGCATTGCATTGGATTCACTACTAGGAAAATTGTTTTCCTAGACA[A/G]
CCAAAAGTAGTTTTTTCAGGCAGGAGAAAGGACCGCATTGTCGATGGTGGATACCCGTAGACCGGATATAGAGGGTATTGGGGTACACTGCTACGAGGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 33.10% 0.40% 0.00% NA
All Indica  2759 75.90% 23.90% 0.25% 0.00% NA
All Japonica  1512 59.50% 39.90% 0.60% 0.00% NA
Aus  269 30.50% 68.80% 0.74% 0.00% NA
Indica I  595 92.30% 7.20% 0.50% 0.00% NA
Indica II  465 59.60% 40.00% 0.43% 0.00% NA
Indica III  913 76.10% 23.90% 0.00% 0.00% NA
Indica Intermediate  786 72.80% 27.00% 0.25% 0.00% NA
Temperate Japonica  767 87.00% 12.90% 0.13% 0.00% NA
Tropical Japonica  504 32.30% 66.50% 1.19% 0.00% NA
Japonica Intermediate  241 29.00% 70.10% 0.83% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 68.90% 30.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117147805 T -> C LOC_Os11g29540.1 upstream_gene_variant ; 3590.0bp to feature; MODIFIER silent_mutation Average:49.167; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg1117147805 T -> C LOC_Os11g29560.1 upstream_gene_variant ; 1814.0bp to feature; MODIFIER silent_mutation Average:49.167; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg1117147805 T -> C LOC_Os11g29550.1 downstream_gene_variant ; 882.0bp to feature; MODIFIER silent_mutation Average:49.167; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg1117147805 T -> C LOC_Os11g29550-LOC_Os11g29560 intergenic_region ; MODIFIER silent_mutation Average:49.167; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117147805 NA 3.75E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117147805 NA 1.54E-07 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117147805 8.10E-06 NA mr1584_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117147805 NA 3.14E-07 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117147805 1.71E-06 1.71E-06 mr1693_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117147805 NA 1.11E-08 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117147805 7.57E-06 1.32E-06 mr1762_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251