Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117147805:

Variant ID: vg1117147805 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17147805
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.05, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

ATCCTCGTAGCAGTGTACCCCAATACCCTCTATATCCGGTCTACGGGTATCCACCATCGACAATGCGGTCCTTTCTCCTGCCTGAAAAAACTACTTTTGG[T/C]
TGTCTAGGAAAACAATTTTCCTAGTAGTGAATCCAATGCAATGCGTTCTGATATGTTTGGCGACATTCTCATCTCTTTTTTTCCCTTCACCTCCACTAAA

Reverse complement sequence

TTTAGTGGAGGTGAAGGGAAAAAAAGAGATGAGAATGTCGCCAAACATATCAGAACGCATTGCATTGGATTCACTACTAGGAAAATTGTTTTCCTAGACA[A/G]
CCAAAAGTAGTTTTTTCAGGCAGGAGAAAGGACCGCATTGTCGATGGTGGATACCCGTAGACCGGATATAGAGGGTATTGGGGTACACTGCTACGAGGAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.50%	33.10%	0.40%	0.00%	NA
All Indica	2759	75.90%	23.90%	0.25%	0.00%	NA
All Japonica	1512	59.50%	39.90%	0.60%	0.00%	NA
Aus	269	30.50%	68.80%	0.74%	0.00%	NA
Indica I	595	92.30%	7.20%	0.50%	0.00%	NA
Indica II	465	59.60%	40.00%	0.43%	0.00%	NA
Indica III	913	76.10%	23.90%	0.00%	0.00%	NA
Indica Intermediate	786	72.80%	27.00%	0.25%	0.00%	NA
Temperate Japonica	767	87.00%	12.90%	0.13%	0.00%	NA
Tropical Japonica	504	32.30%	66.50%	1.19%	0.00%	NA
Japonica Intermediate	241	29.00%	70.10%	0.83%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	68.90%	30.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117147805	T -> C	LOC_Os11g29540.1	upstream_gene_variant ; 3590.0bp to feature; MODIFIER	silent_mutation	Average:49.167; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg1117147805	T -> C	LOC_Os11g29560.1	upstream_gene_variant ; 1814.0bp to feature; MODIFIER	silent_mutation	Average:49.167; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg1117147805	T -> C	LOC_Os11g29550.1	downstream_gene_variant ; 882.0bp to feature; MODIFIER	silent_mutation	Average:49.167; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg1117147805	T -> C	LOC_Os11g29550-LOC_Os11g29560	intergenic_region ; MODIFIER	silent_mutation	Average:49.167; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117147805	NA	3.75E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117147805	NA	1.54E-07	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117147805	8.10E-06	NA	mr1584_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117147805	NA	3.14E-07	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117147805	1.71E-06	1.71E-06	mr1693_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117147805	NA	1.11E-08	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117147805	7.57E-06	1.32E-06	mr1762_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251