Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117147454:

Variant ID: vg1117147454 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17147454
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, A: 0.35, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

ACTGGGTCATTACTGTATCGTGTGGGGTCCGATGTCTCCGAGTTCTACTTGGAGACCAACTGACCCGCGGTATAAAATGGACCCCCCGGGAGGACCTAAG[A/G]
CATCGAATCTCACCGCCAACACATCCACCACAGCCTATGAAGTCGGAGCCTACAGGAGCCAAGTCGCCGGGTGATCTAGTCGAACCTACTCGACTACGGT

Reverse complement sequence

ACCGTAGTCGAGTAGGTTCGACTAGATCACCCGGCGACTTGGCTCCTGTAGGCTCCGACTTCATAGGCTGTGGTGGATGTGTTGGCGGTGAGATTCGATG[T/C]
CTTAGGTCCTCCCGGGGGGTCCATTTTATACCGCGGGTCAGTTGGTCTCCAAGTAGAACTCGGAGACATCGGACCCCACACGATACAGTAATGACCCAGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.50%	19.30%	12.65%	13.52%	NA
All Indica	2759	76.70%	5.80%	11.45%	6.09%	NA
All Japonica	1512	18.70%	47.10%	9.72%	24.47%	NA
Aus	269	26.00%	9.70%	36.80%	27.51%	NA
Indica I	595	89.40%	4.40%	5.04%	1.18%	NA
Indica II	465	59.80%	14.60%	20.22%	5.38%	NA
Indica III	913	80.50%	0.30%	8.98%	10.19%	NA
Indica Intermediate	786	72.60%	7.90%	13.99%	5.47%	NA
Temperate Japonica	767	2.90%	84.90%	3.91%	8.34%	NA
Tropical Japonica	504	40.90%	3.80%	11.71%	43.65%	NA
Japonica Intermediate	241	22.80%	17.40%	24.07%	35.68%	NA
VI/Aromatic	96	52.10%	0.00%	23.96%	23.96%	NA
Intermediate	90	64.40%	16.70%	14.44%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117147454	A -> DEL	N	N	silent_mutation	Average:49.943; most accessible tissue: Minghui63 flag leaf, score: 68.675	N	N	N	N
vg1117147454	A -> G	LOC_Os11g29540.1	upstream_gene_variant ; 3239.0bp to feature; MODIFIER	silent_mutation	Average:49.943; most accessible tissue: Minghui63 flag leaf, score: 68.675	N	N	N	N
vg1117147454	A -> G	LOC_Os11g29560.1	upstream_gene_variant ; 2165.0bp to feature; MODIFIER	silent_mutation	Average:49.943; most accessible tissue: Minghui63 flag leaf, score: 68.675	N	N	N	N
vg1117147454	A -> G	LOC_Os11g29550.1	downstream_gene_variant ; 531.0bp to feature; MODIFIER	silent_mutation	Average:49.943; most accessible tissue: Minghui63 flag leaf, score: 68.675	N	N	N	N
vg1117147454	A -> G	LOC_Os11g29550-LOC_Os11g29560	intergenic_region ; MODIFIER	silent_mutation	Average:49.943; most accessible tissue: Minghui63 flag leaf, score: 68.675	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117147454	NA	2.67E-07	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117147454	7.65E-06	7.65E-06	mr1693_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117147454	NA	6.05E-06	mr1762_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117147454	NA	4.00E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117147454	NA	7.15E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117147454	NA	8.86E-06	mr1922_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251