\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117144922:

Variant ID: vg1117144922 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17144922
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.55, G: 0.45, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


CACAACGCGATCCTGGAAGAAAAAGATAAAAGGGTCGTTGAGTACACTCACGTTGATTGCAGCTTCGCGTTCGGCCGTCCCCTCCTCGCAAAGGGGGACG[A/G]
CGATGTTGCTCGCCGTTGTGGGGCCGCTGATCATTACTTGACCGACGCAGCGCTCCACAGTTTCGCTGTTCAAACCTGTAGGATCGAGAAGCAGAACTCG

Reverse complement sequence

CGAGTTCTGCTTCTCGATCCTACAGGTTTGAACAGCGAAACTGTGGAGCGCTGCGTCGGTCAAGTAATGATCAGCGGCCCCACAACGGCGAGCAACATCG[T/C]
CGTCCCCCTTTGCGAGGAGGGGACGGCCGAACGCGAAGCTGCAATCAACGTGAGTGTACTCAACGACCCTTTTATCTTTTTCTTCCAGGATCGCGTTGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.20% 19.10% 0.99% 31.70% NA
All Indica  2759 71.20% 5.60% 0.65% 22.58% NA
All Japonica  1512 13.00% 46.80% 1.19% 38.96% NA
Aus  269 23.80% 8.20% 0.74% 67.29% NA
Indica I  595 88.60% 4.00% 1.18% 6.22% NA
Indica II  465 46.50% 14.40% 0.86% 38.28% NA
Indica III  913 75.90% 0.20% 0.11% 23.77% NA
Indica Intermediate  786 67.20% 7.80% 0.76% 24.30% NA
Temperate Japonica  767 2.20% 84.60% 0.52% 12.65% NA
Tropical Japonica  504 30.20% 3.40% 1.98% 64.48% NA
Japonica Intermediate  241 11.60% 17.40% 1.66% 69.29% NA
VI/Aromatic  96 8.30% 1.00% 6.25% 84.38% NA
Intermediate  90 52.20% 17.80% 3.33% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117144922 A -> DEL N N silent_mutation Average:55.831; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N
vg1117144922 A -> G LOC_Os11g29540.1 upstream_gene_variant ; 707.0bp to feature; MODIFIER silent_mutation Average:55.831; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N
vg1117144922 A -> G LOC_Os11g29550.1 upstream_gene_variant ; 246.0bp to feature; MODIFIER silent_mutation Average:55.831; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N
vg1117144922 A -> G LOC_Os11g29560.1 upstream_gene_variant ; 4697.0bp to feature; MODIFIER silent_mutation Average:55.831; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N
vg1117144922 A -> G LOC_Os11g29530.1 downstream_gene_variant ; 3048.0bp to feature; MODIFIER silent_mutation Average:55.831; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N
vg1117144922 A -> G LOC_Os11g29540-LOC_Os11g29550 intergenic_region ; MODIFIER silent_mutation Average:55.831; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117144922 NA 1.24E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117144922 2.88E-06 2.88E-06 mr1050_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117144922 NA 3.51E-06 mr1957_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251