Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117141737:

Variant ID: vg1117141737 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17141737
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

CTCTGTACTATGGGCCATGCGTACCACACCGACAACATCCAACAAGGAGACACCCTTCTTCCTCGTGTACGGCTCAGAGGCCATGCTCCCCACTGAGCTA[C/T]
AACATCAGAGTACACGAGTACAGAAGTACTTAGACGAGGACCAGGAGGAGCAGCGAAACGACGACGTGAATCTACTCGAGGAACATCGAGAAAGAGTTGC

Reverse complement sequence

GCAACTCTTTCTCGATGTTCCTCGAGTAGATTCACGTCGTCGTTTCGCTGCTCCTCCTGGTCCTCGTCTAAGTACTTCTGTACTCGTGTACTCTGATGTT[G/A]
TAGCTCAGTGGGGAGCATGGCCTCTGAGCCGTACACGAGGAAGAAGGGTGTCTCCTTGTTGGATGTTGTCGGTGTGGTACGCATGGCCCATAGTACAGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.10%	11.20%	11.79%	12.97%	NA
All Indica	2759	65.30%	18.60%	14.03%	2.07%	NA
All Japonica	1512	59.30%	0.20%	7.34%	33.20%	NA
Aus	269	89.20%	0.00%	10.04%	0.74%	NA
Indica I	595	84.70%	5.50%	4.87%	4.87%	NA
Indica II	465	66.90%	14.40%	18.71%	0.00%	NA
Indica III	913	52.20%	30.30%	16.65%	0.77%	NA
Indica Intermediate	786	64.80%	17.40%	15.14%	2.67%	NA
Temperate Japonica	767	89.80%	0.00%	1.04%	9.13%	NA
Tropical Japonica	504	24.60%	0.60%	17.26%	57.54%	NA
Japonica Intermediate	241	34.40%	0.00%	6.64%	58.92%	NA
VI/Aromatic	96	30.20%	1.00%	22.92%	45.83%	NA
Intermediate	90	70.00%	10.00%	11.11%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117141737	C -> T	LOC_Os11g29530.1	stop_gained ; p.Gln1172*; HIGH	stop_gained	Average:51.654; most accessible tissue: Minghui63 young leaf, score: 74.514	N	N	N	N
vg1117141737	C -> DEL	LOC_Os11g29530.1	N	frameshift_variant	Average:51.654; most accessible tissue: Minghui63 young leaf, score: 74.514	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117141737	NA	4.79E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141737	NA	9.19E-06	mr1046	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141737	NA	3.95E-06	mr1115	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141737	NA	9.71E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141737	NA	7.07E-07	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141737	9.65E-06	9.65E-06	mr1230	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141737	NA	7.16E-06	mr1353	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141737	NA	6.29E-06	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141737	NA	2.74E-07	mr1428	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141737	NA	3.69E-07	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141737	NA	9.80E-07	mr1550	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141737	NA	1.15E-06	mr1614	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141737	NA	6.49E-06	mr1671	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141737	NA	6.68E-06	mr1807	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141737	NA	6.34E-06	mr1821	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141737	1.25E-06	1.26E-06	mr1869	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141737	2.54E-07	2.54E-07	mr1869	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141737	NA	3.38E-06	mr1941	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251