\
| Variant ID: vg1117141200 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17141200 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 94. )
AGCTTTTCGACAAGGGTTTTTCTGGCCGACCGCCCTTAAAGACGCTTGCGACATGGTTCAGCAGTGTGAAGCCTGTCAATTCCACAGTAAACACACGAAG[C/T]
TACCAGCACAAGCGCTCCAGACTATCCCTCTTACTTGGCCATTCTCGTGCTAGGGGCTCGACATACTTGGACCATTCCGACGAGGACAGGGCGGCTACAG
CTGTAGCCGCCCTGTCCTCGTCGGAATGGTCCAAGTATGTCGAGCCCCTAGCACGAGAATGGCCAAGTAAGAGGGATAGTCTGGAGCGCTTGTGCTGGTA[G/A]
CTTCGTGTGTTTACTGTGGAATTGACAGGCTTCACACTGCTGAACCATGTCGCAAGCGTCTTTAAGGGCGGTCGGCCAGAAAAACCCTTGTCGAAAAGCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.40% | 5.10% | 1.71% | 11.81% | NA |
| All Indica | 2759 | 86.10% | 4.70% | 0.54% | 8.63% | NA |
| All Japonica | 1512 | 71.10% | 6.50% | 3.77% | 18.65% | NA |
| Aus | 269 | 87.70% | 0.40% | 2.23% | 9.67% | NA |
| Indica I | 595 | 86.40% | 12.10% | 0.00% | 1.51% | NA |
| Indica II | 465 | 85.20% | 0.00% | 0.65% | 14.19% | NA |
| Indica III | 913 | 85.20% | 3.20% | 0.66% | 10.95% | NA |
| Indica Intermediate | 786 | 87.40% | 3.80% | 0.76% | 8.02% | NA |
| Temperate Japonica | 767 | 92.40% | 0.70% | 0.39% | 6.52% | NA |
| Tropical Japonica | 504 | 52.00% | 14.90% | 6.15% | 26.98% | NA |
| Japonica Intermediate | 241 | 43.20% | 7.50% | 9.54% | 39.83% | NA |
| VI/Aromatic | 96 | 90.60% | 0.00% | 1.04% | 8.33% | NA |
| Intermediate | 90 | 81.10% | 12.20% | 2.22% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117141200 | C -> T | LOC_Os11g29550.1 | upstream_gene_variant ; 3968.0bp to feature; MODIFIER | silent_mutation | Average:51.921; most accessible tissue: Minghui63 flag leaf, score: 77.153 | N | N | N | N |
| vg1117141200 | C -> T | LOC_Os11g29540.1 | downstream_gene_variant ; 1777.0bp to feature; MODIFIER | silent_mutation | Average:51.921; most accessible tissue: Minghui63 flag leaf, score: 77.153 | N | N | N | N |
| vg1117141200 | C -> T | LOC_Os11g29530.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.921; most accessible tissue: Minghui63 flag leaf, score: 77.153 | N | N | N | N |
| vg1117141200 | C -> DEL | N | N | silent_mutation | Average:51.921; most accessible tissue: Minghui63 flag leaf, score: 77.153 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117141200 | NA | 7.44E-06 | mr1564 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117141200 | 5.66E-06 | 3.87E-07 | mr1564 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117141200 | NA | 8.09E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117141200 | NA | 6.27E-06 | mr1681_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117141200 | NA | 7.90E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117141200 | NA | 7.10E-07 | mr1959_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |