\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117137503:

Variant ID: vg1117137503 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17137503
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.02, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GCGTTGGCAAATTATTTGCGGCGGCGTTGAAAGGATCTGCACGTTCATGGCTAGTCCACCTCCCACCATACTCGATTTCTTCATGGGCAGATCTGTGGCA[A/G]
CAGTTCGTCGCTAACTTCCAAGGAACATACAAGTGCCACGCGATCGAAGACGACCTACATGCGTTGACACAAAATCCGGGCGAATCATTGAGGGACTACA

Reverse complement sequence

TGTAGTCCCTCAATGATTCGCCCGGATTTTGTGTCAACGCATGTAGGTCGTCTTCGATCGCGTGGCACTTGTATGTTCCTTGGAAGTTAGCGACGAACTG[T/C]
TGCCACAGATCTGCCCATGAAGAAATCGAGTATGGTGGGAGGTGGACTAGCCATGAACGTGCAGATCCTTTCAACGCCGCCGCAAATAATTTGCCAACGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 30.90% 7.26% 8.19% NA
All Indica  2759 56.40% 25.40% 9.24% 8.99% NA
All Japonica  1512 54.60% 31.70% 4.89% 8.73% NA
Aus  269 32.70% 62.80% 2.97% 1.49% NA
Indica I  595 69.70% 10.60% 9.58% 10.08% NA
Indica II  465 51.60% 35.50% 7.53% 5.38% NA
Indica III  913 50.30% 27.60% 10.62% 11.50% NA
Indica Intermediate  786 56.20% 28.00% 8.40% 7.38% NA
Temperate Japonica  767 83.40% 5.30% 4.30% 6.91% NA
Tropical Japonica  504 23.80% 63.10% 5.75% 7.34% NA
Japonica Intermediate  241 27.40% 50.20% 4.98% 17.43% NA
VI/Aromatic  96 9.40% 86.50% 2.08% 2.08% NA
Intermediate  90 62.20% 32.20% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117137503 A -> DEL N N silent_mutation Average:56.509; most accessible tissue: Minghui63 flag leaf, score: 73.752 N N N N
vg1117137503 A -> G LOC_Os11g29530.1 intron_variant ; MODIFIER silent_mutation Average:56.509; most accessible tissue: Minghui63 flag leaf, score: 73.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117137503 8.02E-10 1.71E-10 mr1113 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 1.53E-10 3.40E-11 mr1114 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 1.63E-06 3.07E-07 mr1116 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 1.51E-10 1.82E-11 mr1117 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 3.38E-07 1.89E-07 mr1118 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 2.94E-07 2.09E-07 mr1119 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 5.05E-07 9.76E-08 mr1120 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 7.46E-07 3.09E-07 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 2.42E-06 2.68E-07 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 7.25E-08 1.51E-08 mr1242 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 3.57E-10 4.46E-11 mr1247 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 1.55E-08 2.21E-09 mr1496 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 1.67E-07 1.43E-08 mr1917 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 6.44E-06 3.54E-06 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 NA 9.79E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 4.14E-08 1.29E-09 mr1113_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 1.60E-10 3.37E-12 mr1114_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 7.92E-13 3.29E-14 mr1117_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 1.55E-07 2.40E-08 mr1118_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 1.18E-08 2.05E-10 mr1119_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 1.42E-08 3.49E-10 mr1120_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 1.12E-08 5.08E-09 mr1123_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 1.25E-09 3.45E-11 mr1240_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 1.82E-08 1.72E-09 mr1242_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 2.91E-08 5.19E-10 mr1247_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 1.25E-08 8.45E-10 mr1496_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 5.08E-08 4.44E-08 mr1936_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117137503 1.69E-06 9.00E-07 mr1961_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251