Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117135476:

Variant ID: vg1117135476 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17135476
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTACTCGGGCAGAACTGGGTCGTTACCGTATCGTGTGGGGTCCGATGTCTCTGAGTTCTACTTGGAGACCAACTGACCCGCGGTATAAAAGGGACCCCCC[G/A]
GGAGGACCTAAGGCATCGAATCTCACCGCCAATACATCCACCACAGCCTACGAAGTCGGAGCCTACAGGAGCCAAATCGTTGGGTGATCTAATCGAACCT

Reverse complement sequence

AGGTTCGATTAGATCACCCAACGATTTGGCTCCTGTAGGCTCCGACTTCGTAGGCTGTGGTGGATGTATTGGCGGTGAGATTCGATGCCTTAGGTCCTCC[C/T]
GGGGGGTCCCTTTTATACCGCGGGTCAGTTGGTCTCCAAGTAGAACTCAGAGACATCGGACCCCACACGATACGGTAACGACCCAGTTCTGCCCGAGTAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.30%	9.80%	5.63%	8.29%	NA
All Indica	2759	76.40%	14.60%	6.56%	2.36%	NA
All Japonica	1512	72.90%	3.50%	3.37%	20.17%	NA
Aus	269	88.50%	0.00%	11.15%	0.37%	NA
Indica I	595	77.30%	3.00%	12.27%	7.39%	NA
Indica II	465	83.00%	10.80%	5.38%	0.86%	NA
Indica III	913	69.20%	25.60%	4.27%	0.88%	NA
Indica Intermediate	786	80.30%	13.00%	5.60%	1.15%	NA
Temperate Japonica	767	89.30%	0.10%	0.26%	10.30%	NA
Tropical Japonica	504	60.70%	10.30%	7.94%	21.03%	NA
Japonica Intermediate	241	46.50%	0.00%	3.73%	49.79%	NA
VI/Aromatic	96	79.20%	0.00%	3.12%	17.71%	NA
Intermediate	90	88.90%	5.60%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117135476	G -> A	LOC_Os11g29520.1	upstream_gene_variant ; 3260.0bp to feature; MODIFIER	silent_mutation	Average:69.846; most accessible tissue: Zhenshan97 flag leaf, score: 84.726	N	N	N	N
vg1117135476	G -> A	LOC_Os11g29530.1	upstream_gene_variant ; 438.0bp to feature; MODIFIER	silent_mutation	Average:69.846; most accessible tissue: Zhenshan97 flag leaf, score: 84.726	N	N	N	N
vg1117135476	G -> A	LOC_Os11g29520-LOC_Os11g29530	intergenic_region ; MODIFIER	silent_mutation	Average:69.846; most accessible tissue: Zhenshan97 flag leaf, score: 84.726	N	N	N	N
vg1117135476	G -> DEL	N	N	silent_mutation	Average:69.846; most accessible tissue: Zhenshan97 flag leaf, score: 84.726	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117135476	NA	1.64E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476	9.63E-06	9.63E-06	mr1230	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476	NA	5.01E-06	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476	NA	2.12E-06	mr1583	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476	NA	9.50E-06	mr1671	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476	NA	7.56E-06	mr1821	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476	NA	3.52E-06	mr1956	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476	NA	3.19E-06	mr1956	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476	4.98E-06	4.99E-06	mr1424_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476	NA	6.44E-06	mr1638_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476	NA	1.80E-06	mr1638_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476	NA	8.62E-06	mr1671_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476	NA	1.86E-06	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251