\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117135476:

Variant ID: vg1117135476 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17135476
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTACTCGGGCAGAACTGGGTCGTTACCGTATCGTGTGGGGTCCGATGTCTCTGAGTTCTACTTGGAGACCAACTGACCCGCGGTATAAAAGGGACCCCCC[G/A]
GGAGGACCTAAGGCATCGAATCTCACCGCCAATACATCCACCACAGCCTACGAAGTCGGAGCCTACAGGAGCCAAATCGTTGGGTGATCTAATCGAACCT

Reverse complement sequence

AGGTTCGATTAGATCACCCAACGATTTGGCTCCTGTAGGCTCCGACTTCGTAGGCTGTGGTGGATGTATTGGCGGTGAGATTCGATGCCTTAGGTCCTCC[C/T]
GGGGGGTCCCTTTTATACCGCGGGTCAGTTGGTCTCCAAGTAGAACTCAGAGACATCGGACCCCACACGATACGGTAACGACCCAGTTCTGCCCGAGTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.30% 9.80% 5.63% 8.29% NA
All Indica  2759 76.40% 14.60% 6.56% 2.36% NA
All Japonica  1512 72.90% 3.50% 3.37% 20.17% NA
Aus  269 88.50% 0.00% 11.15% 0.37% NA
Indica I  595 77.30% 3.00% 12.27% 7.39% NA
Indica II  465 83.00% 10.80% 5.38% 0.86% NA
Indica III  913 69.20% 25.60% 4.27% 0.88% NA
Indica Intermediate  786 80.30% 13.00% 5.60% 1.15% NA
Temperate Japonica  767 89.30% 0.10% 0.26% 10.30% NA
Tropical Japonica  504 60.70% 10.30% 7.94% 21.03% NA
Japonica Intermediate  241 46.50% 0.00% 3.73% 49.79% NA
VI/Aromatic  96 79.20% 0.00% 3.12% 17.71% NA
Intermediate  90 88.90% 5.60% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117135476 G -> A LOC_Os11g29520.1 upstream_gene_variant ; 3260.0bp to feature; MODIFIER silent_mutation Average:69.846; most accessible tissue: Zhenshan97 flag leaf, score: 84.726 N N N N
vg1117135476 G -> A LOC_Os11g29530.1 upstream_gene_variant ; 438.0bp to feature; MODIFIER silent_mutation Average:69.846; most accessible tissue: Zhenshan97 flag leaf, score: 84.726 N N N N
vg1117135476 G -> A LOC_Os11g29520-LOC_Os11g29530 intergenic_region ; MODIFIER silent_mutation Average:69.846; most accessible tissue: Zhenshan97 flag leaf, score: 84.726 N N N N
vg1117135476 G -> DEL N N silent_mutation Average:69.846; most accessible tissue: Zhenshan97 flag leaf, score: 84.726 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117135476 NA 1.64E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476 9.63E-06 9.63E-06 mr1230 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476 NA 5.01E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476 NA 2.12E-06 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476 NA 9.50E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476 NA 7.56E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476 NA 3.52E-06 mr1956 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476 NA 3.19E-06 mr1956 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476 4.98E-06 4.99E-06 mr1424_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476 NA 6.44E-06 mr1638_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476 NA 1.80E-06 mr1638_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476 NA 8.62E-06 mr1671_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117135476 NA 1.86E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251