\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117116576:

Variant ID: vg1117116576 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17116576
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.16, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


TGCCGGAGCCGCTGCCACCACCTGCGCGAGCCGCCATCGCCTGTGTATGGGGAGGGAGGAGAGGATGCTGGTGGCTGGATCTGGAGGAAGGAGATGCGCG[C/T]
GGTAGCGGCGGCAGGTGTGAGCAGAGCGGAGGAGGAAGGGCGGGTGGTGGCGGTGGCGGGCGTGGGAGCGAACCGGAGGAGGAGCGAAACCGGCGGTGAC

Reverse complement sequence

GTCACCGCCGGTTTCGCTCCTCCTCCGGTTCGCTCCCACGCCCGCCACCGCCACCACCCGCCCTTCCTCCTCCGCTCTGCTCACACCTGCCGCCGCTACC[G/A]
CGCGCATCTCCTTCCTCCAGATCCAGCCACCAGCATCCTCTCCTCCCTCCCCATACACAGGCGATGGCGGCTCGCGCAGGTGGTGGCAGCGGCTCCGGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.70% 26.20% 0.55% 17.54% NA
All Indica  2759 55.30% 41.30% 0.58% 2.79% NA
All Japonica  1512 57.20% 1.30% 0.33% 41.14% NA
Aus  269 68.40% 19.70% 0.74% 11.15% NA
Indica I  595 27.60% 64.00% 0.84% 7.56% NA
Indica II  465 72.70% 26.50% 0.65% 0.22% NA
Indica III  913 63.20% 36.50% 0.11% 0.22% NA
Indica Intermediate  786 56.90% 38.50% 0.89% 3.69% NA
Temperate Japonica  767 84.90% 1.30% 0.13% 13.69% NA
Tropical Japonica  504 30.60% 1.20% 0.20% 68.06% NA
Japonica Intermediate  241 24.90% 1.70% 1.24% 72.20% NA
VI/Aromatic  96 7.30% 3.10% 2.08% 87.50% NA
Intermediate  90 56.70% 24.40% 1.11% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117116576 C -> T LOC_Os11g29500.1 5_prime_UTR_variant ; 199.0bp to feature; MODIFIER silent_mutation Average:97.964; most accessible tissue: Zhenshan97 young leaf, score: 99.265 N N N N
vg1117116576 C -> T LOC_Os11g29490.1 downstream_gene_variant ; 2461.0bp to feature; MODIFIER silent_mutation Average:97.964; most accessible tissue: Zhenshan97 young leaf, score: 99.265 N N N N
vg1117116576 C -> T LOC_Os11g29510.1 downstream_gene_variant ; 1297.0bp to feature; MODIFIER silent_mutation Average:97.964; most accessible tissue: Zhenshan97 young leaf, score: 99.265 N N N N
vg1117116576 C -> T LOC_Os11g29490.2 downstream_gene_variant ; 2461.0bp to feature; MODIFIER silent_mutation Average:97.964; most accessible tissue: Zhenshan97 young leaf, score: 99.265 N N N N
vg1117116576 C -> T LOC_Os11g29490.3 downstream_gene_variant ; 977.0bp to feature; MODIFIER silent_mutation Average:97.964; most accessible tissue: Zhenshan97 young leaf, score: 99.265 N N N N
vg1117116576 C -> DEL N N silent_mutation Average:97.964; most accessible tissue: Zhenshan97 young leaf, score: 99.265 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1117116576 C T 0.04 0.03 0.05 0.06 0.07 0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117116576 NA 3.55E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117116576 NA 2.47E-06 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117116576 NA 4.30E-09 mr1534 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117116576 NA 2.48E-06 mr1637 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117116576 NA 2.69E-06 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117116576 NA 4.39E-06 mr1751 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117116576 NA 1.90E-07 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117116576 NA 3.14E-06 mr1928 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117116576 NA 3.88E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251