Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117103676:

Variant ID: vg1117103676 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17103676
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

GGCCCAAGGCCTCATCTGTAACAACATCCAGTTCAACCTATCACATATGTGGTCATCCGTGACAAGGCACTAGCTTTGTCCTATCATCCCACAATGCATA[C/T]
AAGACCATCACAAAGTTCAGCCATGTACTATCTCCTTCATTGTGCAATTCCACCAATCTGGTCTCAATAAGAAAAATTAAGTGATTATCCAGTAGTTCCG

Reverse complement sequence

CGGAACTACTGGATAATCACTTAATTTTTCTTATTGAGACCAGATTGGTGGAATTGCACAATGAAGGAGATAGTACATGGCTGAACTTTGTGATGGTCTT[G/A]
TATGCATTGTGGGATGATAGGACAAAGCTAGTGCCTTGTCACGGATGACCACATATGTGATAGGTTGAACTGGATGTTGTTACAGATGAGGCCTTGGGCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.40%	7.60%	1.10%	43.97%	NA
All Indica	2759	39.10%	12.50%	1.20%	47.26%	NA
All Japonica	1512	57.50%	0.50%	0.93%	41.14%	NA
Aus	269	87.00%	0.00%	0.37%	12.64%	NA
Indica I	595	35.80%	0.50%	0.67%	63.03%	NA
Indica II	465	38.70%	13.50%	1.72%	46.02%	NA
Indica III	913	39.80%	20.20%	0.66%	39.43%	NA
Indica Intermediate	786	41.00%	12.00%	1.91%	45.17%	NA
Temperate Japonica	767	85.80%	0.00%	0.39%	13.82%	NA
Tropical Japonica	504	29.80%	1.40%	1.79%	67.06%	NA
Japonica Intermediate	241	25.30%	0.00%	0.83%	73.86%	NA
VI/Aromatic	96	9.40%	1.00%	2.08%	87.50%	NA
Intermediate	90	54.40%	5.60%	2.22%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117103676	C -> T	LOC_Os11g29470.1	upstream_gene_variant ; 3483.0bp to feature; MODIFIER	silent_mutation	Average:45.047; most accessible tissue: Callus, score: 99.391	N	N	N	N
vg1117103676	C -> T	LOC_Os11g29480.1	upstream_gene_variant ; 1692.0bp to feature; MODIFIER	silent_mutation	Average:45.047; most accessible tissue: Callus, score: 99.391	N	N	N	N
vg1117103676	C -> T	LOC_Os11g29470-LOC_Os11g29480	intergenic_region ; MODIFIER	silent_mutation	Average:45.047; most accessible tissue: Callus, score: 99.391	N	N	N	N
vg1117103676	C -> DEL	N	N	silent_mutation	Average:45.047; most accessible tissue: Callus, score: 99.391	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117103676	NA	7.05E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	NA	8.01E-06	mr1046	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	NA	2.82E-06	mr1060	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	NA	3.69E-06	mr1060	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	NA	8.39E-07	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	NA	8.16E-06	mr1353	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	NA	7.07E-06	mr1372	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	NA	1.10E-06	mr1377	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	NA	5.59E-06	mr1428	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	NA	2.19E-07	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	NA	9.50E-07	mr1550	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	NA	1.95E-06	mr1583	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	NA	1.51E-06	mr1614	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	NA	5.89E-06	mr1671	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	NA	4.02E-06	mr1724	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	NA	7.82E-06	mr1751	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	NA	5.90E-06	mr1821	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	5.60E-06	5.63E-06	mr1869	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	2.70E-06	2.70E-06	mr1869	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	NA	2.08E-06	mr1956	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	NA	7.08E-07	mr1956	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	NA	9.77E-07	mr1958	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	3.27E-06	3.28E-06	mr1314_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676	2.41E-06	2.41E-06	mr1314_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251