\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117103676:

Variant ID: vg1117103676 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17103676
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


GGCCCAAGGCCTCATCTGTAACAACATCCAGTTCAACCTATCACATATGTGGTCATCCGTGACAAGGCACTAGCTTTGTCCTATCATCCCACAATGCATA[C/T]
AAGACCATCACAAAGTTCAGCCATGTACTATCTCCTTCATTGTGCAATTCCACCAATCTGGTCTCAATAAGAAAAATTAAGTGATTATCCAGTAGTTCCG

Reverse complement sequence

CGGAACTACTGGATAATCACTTAATTTTTCTTATTGAGACCAGATTGGTGGAATTGCACAATGAAGGAGATAGTACATGGCTGAACTTTGTGATGGTCTT[G/A]
TATGCATTGTGGGATGATAGGACAAAGCTAGTGCCTTGTCACGGATGACCACATATGTGATAGGTTGAACTGGATGTTGTTACAGATGAGGCCTTGGGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.40% 7.60% 1.10% 43.97% NA
All Indica  2759 39.10% 12.50% 1.20% 47.26% NA
All Japonica  1512 57.50% 0.50% 0.93% 41.14% NA
Aus  269 87.00% 0.00% 0.37% 12.64% NA
Indica I  595 35.80% 0.50% 0.67% 63.03% NA
Indica II  465 38.70% 13.50% 1.72% 46.02% NA
Indica III  913 39.80% 20.20% 0.66% 39.43% NA
Indica Intermediate  786 41.00% 12.00% 1.91% 45.17% NA
Temperate Japonica  767 85.80% 0.00% 0.39% 13.82% NA
Tropical Japonica  504 29.80% 1.40% 1.79% 67.06% NA
Japonica Intermediate  241 25.30% 0.00% 0.83% 73.86% NA
VI/Aromatic  96 9.40% 1.00% 2.08% 87.50% NA
Intermediate  90 54.40% 5.60% 2.22% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117103676 C -> T LOC_Os11g29470.1 upstream_gene_variant ; 3483.0bp to feature; MODIFIER silent_mutation Average:45.047; most accessible tissue: Callus, score: 99.391 N N N N
vg1117103676 C -> T LOC_Os11g29480.1 upstream_gene_variant ; 1692.0bp to feature; MODIFIER silent_mutation Average:45.047; most accessible tissue: Callus, score: 99.391 N N N N
vg1117103676 C -> T LOC_Os11g29470-LOC_Os11g29480 intergenic_region ; MODIFIER silent_mutation Average:45.047; most accessible tissue: Callus, score: 99.391 N N N N
vg1117103676 C -> DEL N N silent_mutation Average:45.047; most accessible tissue: Callus, score: 99.391 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117103676 NA 7.05E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 NA 8.01E-06 mr1046 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 NA 2.82E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 NA 3.69E-06 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 NA 8.39E-07 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 NA 8.16E-06 mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 NA 7.07E-06 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 NA 1.10E-06 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 NA 5.59E-06 mr1428 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 NA 2.19E-07 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 NA 9.50E-07 mr1550 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 NA 1.95E-06 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 NA 1.51E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 NA 5.89E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 NA 4.02E-06 mr1724 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 NA 7.82E-06 mr1751 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 NA 5.90E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 5.60E-06 5.63E-06 mr1869 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 2.70E-06 2.70E-06 mr1869 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 NA 2.08E-06 mr1956 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 NA 7.08E-07 mr1956 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 NA 9.77E-07 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 3.27E-06 3.28E-06 mr1314_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117103676 2.41E-06 2.41E-06 mr1314_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251