\
| Variant ID: vg1117099141 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17099141 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCAGCTTCCACTTTGTCAGTGGGATCACATTTAAAACAATACTGCCAAATCAAGCAAGAATAATATTATTTTTCCACACTGTTGAGACTATCACAAATCT[G/A]
AGGAAATCTTACCCAAAATCCTTTAAGAACTCGGTCAGCTGGTGACATCATTCTTTCATTTGTAGACCTCTTGTAGTCCCTCCAAGTAAGTGCAGGTGTC
GACACCTGCACTTACTTGGAGGGACTACAAGAGGTCTACAAATGAAAGAATGATGTCACCAGCTGACCGAGTTCTTAAAGGATTTTGGGTAAGATTTCCT[C/T]
AGATTTGTGATAGTCTCAACAGTGTGGAAAAATAATATTATTCTTGCTTGATTTGGCAGTATTGTTTTAAATGTGATCCCACTGACAAAGTGGAAGCTGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.50% | 4.90% | 6.05% | 23.51% | NA |
| All Indica | 2759 | 72.60% | 1.30% | 4.24% | 21.89% | NA |
| All Japonica | 1512 | 52.00% | 12.50% | 9.39% | 26.12% | NA |
| Aus | 269 | 88.10% | 0.00% | 2.97% | 8.92% | NA |
| Indica I | 595 | 79.20% | 0.00% | 7.06% | 13.78% | NA |
| Indica II | 465 | 59.80% | 0.00% | 3.01% | 37.20% | NA |
| Indica III | 913 | 73.90% | 3.00% | 2.63% | 20.48% | NA |
| Indica Intermediate | 786 | 73.50% | 1.10% | 4.71% | 20.61% | NA |
| Temperate Japonica | 767 | 84.70% | 1.20% | 4.04% | 10.04% | NA |
| Tropical Japonica | 504 | 17.50% | 22.20% | 11.51% | 48.81% | NA |
| Japonica Intermediate | 241 | 19.90% | 28.20% | 21.99% | 29.88% | NA |
| VI/Aromatic | 96 | 12.50% | 1.00% | 14.58% | 71.88% | NA |
| Intermediate | 90 | 66.70% | 6.70% | 5.56% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117099141 | G -> A | LOC_Os11g29450.1 | upstream_gene_variant ; 3677.0bp to feature; MODIFIER | silent_mutation | Average:16.53; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg1117099141 | G -> A | LOC_Os11g29470.1 | intron_variant ; MODIFIER | silent_mutation | Average:16.53; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg1117099141 | G -> DEL | N | N | silent_mutation | Average:16.53; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117099141 | NA | 6.57E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117099141 | 1.31E-06 | 2.20E-07 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117099141 | 8.03E-06 | 8.03E-06 | mr1085 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117099141 | 1.43E-06 | 9.09E-09 | mr1408 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117099141 | 4.58E-07 | 2.14E-07 | mr1560 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |