\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117099141:

Variant ID: vg1117099141 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17099141
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAGCTTCCACTTTGTCAGTGGGATCACATTTAAAACAATACTGCCAAATCAAGCAAGAATAATATTATTTTTCCACACTGTTGAGACTATCACAAATCT[G/A]
AGGAAATCTTACCCAAAATCCTTTAAGAACTCGGTCAGCTGGTGACATCATTCTTTCATTTGTAGACCTCTTGTAGTCCCTCCAAGTAAGTGCAGGTGTC

Reverse complement sequence

GACACCTGCACTTACTTGGAGGGACTACAAGAGGTCTACAAATGAAAGAATGATGTCACCAGCTGACCGAGTTCTTAAAGGATTTTGGGTAAGATTTCCT[C/T]
AGATTTGTGATAGTCTCAACAGTGTGGAAAAATAATATTATTCTTGCTTGATTTGGCAGTATTGTTTTAAATGTGATCCCACTGACAAAGTGGAAGCTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.50% 4.90% 6.05% 23.51% NA
All Indica  2759 72.60% 1.30% 4.24% 21.89% NA
All Japonica  1512 52.00% 12.50% 9.39% 26.12% NA
Aus  269 88.10% 0.00% 2.97% 8.92% NA
Indica I  595 79.20% 0.00% 7.06% 13.78% NA
Indica II  465 59.80% 0.00% 3.01% 37.20% NA
Indica III  913 73.90% 3.00% 2.63% 20.48% NA
Indica Intermediate  786 73.50% 1.10% 4.71% 20.61% NA
Temperate Japonica  767 84.70% 1.20% 4.04% 10.04% NA
Tropical Japonica  504 17.50% 22.20% 11.51% 48.81% NA
Japonica Intermediate  241 19.90% 28.20% 21.99% 29.88% NA
VI/Aromatic  96 12.50% 1.00% 14.58% 71.88% NA
Intermediate  90 66.70% 6.70% 5.56% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117099141 G -> A LOC_Os11g29450.1 upstream_gene_variant ; 3677.0bp to feature; MODIFIER silent_mutation Average:16.53; most accessible tissue: Minghui63 root, score: 45.031 N N N N
vg1117099141 G -> A LOC_Os11g29470.1 intron_variant ; MODIFIER silent_mutation Average:16.53; most accessible tissue: Minghui63 root, score: 45.031 N N N N
vg1117099141 G -> DEL N N silent_mutation Average:16.53; most accessible tissue: Minghui63 root, score: 45.031 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117099141 NA 6.57E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117099141 1.31E-06 2.20E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117099141 8.03E-06 8.03E-06 mr1085 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117099141 1.43E-06 9.09E-09 mr1408 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117099141 4.58E-07 2.14E-07 mr1560 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251