Search for Variation information by Variation ID:
Detailed information for vg1117099077:
| Variant ID: vg1117099077 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17099077 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
TCTTTTCTTCTCTTCGAACAACATTTGTGGCACATTCTTCTTGAAATTTTGCTCCAAGACTTTATCAGCTTCCACTTTGTCAGTGGGATCACATTTAAAA[C/T]
AATACTGCCAAATCAAGCAAGAATAATATTATTTTTCCACACTGTTGAGACTATCACAAATCTGAGGAAATCTTACCCAAAATCCTTTAAGAACTCGGTC
Reverse complement sequence
GACCGAGTTCTTAAAGGATTTTGGGTAAGATTTCCTCAGATTTGTGATAGTCTCAACAGTGTGGAAAAATAATATTATTCTTGCTTGATTTGGCAGTATT[G/A]
TTTTAAATGTGATCCCACTGACAAAGTGGAAGCTGATAAAGTCTTGGAGCAAAATTTCAAGAAGAATGTGCCACAAATGTTGTTCGAAGAGAAGAAAAGA
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.50% | 6.20% | 8.70% | 14.66% | NA |
| All Indica | 2759 | 76.40% | 0.10% | 6.52% | 16.89% | NA |
| All Japonica | 1512 | 59.10% | 17.00% | 11.44% | 12.50% | NA |
| Aus | 269 | 91.40% | 0.00% | 6.32% | 2.23% | NA |
| Indica I | 595 | 82.70% | 0.20% | 9.41% | 7.73% | NA |
| Indica II | 465 | 61.30% | 0.00% | 6.02% | 32.69% | NA |
| Indica III | 913 | 79.20% | 0.00% | 4.49% | 16.32% | NA |
| Indica Intermediate | 786 | 77.50% | 0.40% | 7.00% | 15.14% | NA |
| Temperate Japonica | 767 | 86.20% | 2.50% | 7.95% | 3.39% | NA |
| Tropical Japonica | 504 | 32.90% | 25.00% | 14.68% | 27.38% | NA |
| Japonica Intermediate | 241 | 27.40% | 46.50% | 15.77% | 10.37% | NA |
| VI/Aromatic | 96 | 15.60% | 28.10% | 33.33% | 22.92% | NA |
| Intermediate | 90 | 75.60% | 3.30% | 10.00% | 11.11% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117099077 | C -> T | LOC_Os11g29470.1 | missense_variant ; p.Cys80Tyr; MODERATE | nonsynonymous_codon ; C80Y | Average:16.762; most accessible tissue: Minghui63 flag leaf, score: 35.078 | possibly damaging  |
1.825 |
TOLERATED | 0.19 |
| vg1117099077 | C -> DEL | LOC_Os11g29470.1 | N | frameshift_variant | Average:16.762; most accessible tissue: Minghui63 flag leaf, score: 35.078 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117099077 | NA | 7.50E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117099077 | NA | 6.57E-06 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117099077 | NA | 5.68E-07 | mr1560 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117099077 | 2.38E-06 | 2.38E-06 | mr1984_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |