\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117095528:

Variant ID: vg1117095528 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17095528
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CCCATTGACTCTCGAAGCTTTCTCTCTCCTCCGCCATGGATACGAATTGGATGATGCGATTTGGTGTGAAATTGGCCGGGAATGGATGGGAGATCGATGC[G/A]
GTGGTTGCGCGGAAGATTTTAGTGGAGCTCTGGAGGACGGATTGGAGTGGATTTGTGAACCCTAGCTTTCGCCGGTGTGGCTTCATACTATAGCAGAGAG

Reverse complement sequence

CTCTCTGCTATAGTATGAAGCCACACCGGCGAAAGCTAGGGTTCACAAATCCACTCCAATCCGTCCTCCAGAGCTCCACTAAAATCTTCCGCGCAACCAC[C/T]
GCATCGATCTCCCATCCATTCCCGGCCAATTTCACACCAAATCGCATCATCCAATTCGTATCCATGGCGGAGGAGAGAGAAAGCTTCGAGAGTCAATGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.80% 6.10% 0.66% 40.44% NA
All Indica  2759 42.50% 9.90% 0.87% 46.79% NA
All Japonica  1512 67.70% 0.00% 0.26% 32.08% NA
Aus  269 84.40% 3.00% 0.00% 12.64% NA
Indica I  595 32.10% 5.50% 1.68% 60.67% NA
Indica II  465 47.10% 6.00% 0.22% 46.67% NA
Indica III  913 45.60% 14.10% 0.11% 40.20% NA
Indica Intermediate  786 44.00% 10.40% 1.53% 44.02% NA
Temperate Japonica  767 86.30% 0.00% 0.13% 13.56% NA
Tropical Japonica  504 56.90% 0.00% 0.40% 42.66% NA
Japonica Intermediate  241 30.70% 0.00% 0.41% 68.88% NA
VI/Aromatic  96 20.80% 0.00% 3.12% 76.04% NA
Intermediate  90 60.00% 8.90% 0.00% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117095528 G -> A LOC_Os11g29440.1 upstream_gene_variant ; 4105.0bp to feature; MODIFIER silent_mutation Average:35.82; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N
vg1117095528 G -> A LOC_Os11g29450.1 upstream_gene_variant ; 64.0bp to feature; MODIFIER silent_mutation Average:35.82; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N
vg1117095528 G -> A LOC_Os11g29470.1 downstream_gene_variant ; 2588.0bp to feature; MODIFIER silent_mutation Average:35.82; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N
vg1117095528 G -> A LOC_Os11g29450-LOC_Os11g29470 intergenic_region ; MODIFIER silent_mutation Average:35.82; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N
vg1117095528 G -> DEL N N silent_mutation Average:35.82; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117095528 NA 9.03E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117095528 NA 2.73E-06 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117095528 NA 3.60E-07 mr1204 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117095528 NA 3.15E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117095528 NA 6.93E-06 mr1408 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117095528 NA 2.55E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117095528 NA 5.00E-06 mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117095528 NA 2.96E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117095528 NA 6.14E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117095528 4.48E-06 6.58E-07 mr1863 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117095528 1.96E-06 1.96E-06 mr1863 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117095528 NA 5.78E-06 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251