\
| Variant ID: vg1117095528 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17095528 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 99. )
CCCATTGACTCTCGAAGCTTTCTCTCTCCTCCGCCATGGATACGAATTGGATGATGCGATTTGGTGTGAAATTGGCCGGGAATGGATGGGAGATCGATGC[G/A]
GTGGTTGCGCGGAAGATTTTAGTGGAGCTCTGGAGGACGGATTGGAGTGGATTTGTGAACCCTAGCTTTCGCCGGTGTGGCTTCATACTATAGCAGAGAG
CTCTCTGCTATAGTATGAAGCCACACCGGCGAAAGCTAGGGTTCACAAATCCACTCCAATCCGTCCTCCAGAGCTCCACTAAAATCTTCCGCGCAACCAC[C/T]
GCATCGATCTCCCATCCATTCCCGGCCAATTTCACACCAAATCGCATCATCCAATTCGTATCCATGGCGGAGGAGAGAGAAAGCTTCGAGAGTCAATGGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.80% | 6.10% | 0.66% | 40.44% | NA |
| All Indica | 2759 | 42.50% | 9.90% | 0.87% | 46.79% | NA |
| All Japonica | 1512 | 67.70% | 0.00% | 0.26% | 32.08% | NA |
| Aus | 269 | 84.40% | 3.00% | 0.00% | 12.64% | NA |
| Indica I | 595 | 32.10% | 5.50% | 1.68% | 60.67% | NA |
| Indica II | 465 | 47.10% | 6.00% | 0.22% | 46.67% | NA |
| Indica III | 913 | 45.60% | 14.10% | 0.11% | 40.20% | NA |
| Indica Intermediate | 786 | 44.00% | 10.40% | 1.53% | 44.02% | NA |
| Temperate Japonica | 767 | 86.30% | 0.00% | 0.13% | 13.56% | NA |
| Tropical Japonica | 504 | 56.90% | 0.00% | 0.40% | 42.66% | NA |
| Japonica Intermediate | 241 | 30.70% | 0.00% | 0.41% | 68.88% | NA |
| VI/Aromatic | 96 | 20.80% | 0.00% | 3.12% | 76.04% | NA |
| Intermediate | 90 | 60.00% | 8.90% | 0.00% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117095528 | G -> A | LOC_Os11g29440.1 | upstream_gene_variant ; 4105.0bp to feature; MODIFIER | silent_mutation | Average:35.82; most accessible tissue: Minghui63 flag leaf, score: 64.867 | N | N | N | N |
| vg1117095528 | G -> A | LOC_Os11g29450.1 | upstream_gene_variant ; 64.0bp to feature; MODIFIER | silent_mutation | Average:35.82; most accessible tissue: Minghui63 flag leaf, score: 64.867 | N | N | N | N |
| vg1117095528 | G -> A | LOC_Os11g29470.1 | downstream_gene_variant ; 2588.0bp to feature; MODIFIER | silent_mutation | Average:35.82; most accessible tissue: Minghui63 flag leaf, score: 64.867 | N | N | N | N |
| vg1117095528 | G -> A | LOC_Os11g29450-LOC_Os11g29470 | intergenic_region ; MODIFIER | silent_mutation | Average:35.82; most accessible tissue: Minghui63 flag leaf, score: 64.867 | N | N | N | N |
| vg1117095528 | G -> DEL | N | N | silent_mutation | Average:35.82; most accessible tissue: Minghui63 flag leaf, score: 64.867 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117095528 | NA | 9.03E-06 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117095528 | NA | 2.73E-06 | mr1139 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117095528 | NA | 3.60E-07 | mr1204 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117095528 | NA | 3.15E-07 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117095528 | NA | 6.93E-06 | mr1408 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117095528 | NA | 2.55E-07 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117095528 | NA | 5.00E-06 | mr1436 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117095528 | NA | 2.96E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117095528 | NA | 6.14E-06 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117095528 | 4.48E-06 | 6.58E-07 | mr1863 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117095528 | 1.96E-06 | 1.96E-06 | mr1863 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117095528 | NA | 5.78E-06 | mr1587_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |