\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117089560:

Variant ID: vg1117089560 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17089560
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, C: 0.17, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


CGGGTGCCTCTTGGGGCACGATTTTCTCCCAGATCATACGATCAATAACATACTCGGCGGATCAATCCCCGGACAGGAGTAGGGTATTACTTCTTGTTAA[C/G]
AAGGCCTGAACCTGTATAAAATTCCTTGTCTCTCAACCCATCCACTTTTCTAGCTTGATAGCCACCCCCTTTTAGTATTGCCGAAATCTTGTTTCAACAG

Reverse complement sequence

CTGTTGAAACAAGATTTCGGCAATACTAAAAGGGGGTGGCTATCAAGCTAGAAAAGTGGATGGGTTGAGAGACAAGGAATTTTATACAGGTTCAGGCCTT[G/C]
TTAACAAGAAGTAATACCCTACTCCTGTCCGGGGATTGATCCGCCGAGTATGTTATTGATCGTATGATCTGGGAGAAAATCGTGCCCCAAGAGGCACCCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.10% 15.20% 0.40% 45.26% NA
All Indica  2759 49.90% 1.20% 0.51% 48.39% NA
All Japonica  1512 12.40% 44.80% 0.13% 42.66% NA
Aus  269 86.20% 0.40% 0.00% 13.38% NA
Indica I  595 34.30% 2.20% 0.34% 63.19% NA
Indica II  465 51.20% 0.90% 0.22% 47.74% NA
Indica III  913 58.50% 0.20% 0.44% 40.85% NA
Indica Intermediate  786 51.10% 1.70% 0.89% 46.31% NA
Temperate Japonica  767 2.10% 83.10% 0.00% 14.86% NA
Tropical Japonica  504 29.20% 1.00% 0.40% 69.44% NA
Japonica Intermediate  241 10.40% 14.50% 0.00% 75.10% NA
VI/Aromatic  96 8.30% 0.00% 3.12% 88.54% NA
Intermediate  90 46.70% 11.10% 0.00% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117089560 C -> DEL N N silent_mutation Average:26.422; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg1117089560 C -> G LOC_Os11g29430.1 upstream_gene_variant ; 550.0bp to feature; MODIFIER silent_mutation Average:26.422; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg1117089560 C -> G LOC_Os11g29440.1 downstream_gene_variant ; 418.0bp to feature; MODIFIER silent_mutation Average:26.422; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg1117089560 C -> G LOC_Os11g29450.1 downstream_gene_variant ; 2989.0bp to feature; MODIFIER silent_mutation Average:26.422; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg1117089560 C -> G LOC_Os11g29430-LOC_Os11g29440 intergenic_region ; MODIFIER silent_mutation Average:26.422; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117089560 NA 1.98E-07 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117089560 NA 5.20E-07 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117089560 NA 6.55E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117089560 NA 1.36E-06 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117089560 3.10E-06 2.04E-06 mr1707_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251