\
| Variant ID: vg1117089560 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17089560 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, C: 0.17, others allele: 0.00, population size: 77. )
CGGGTGCCTCTTGGGGCACGATTTTCTCCCAGATCATACGATCAATAACATACTCGGCGGATCAATCCCCGGACAGGAGTAGGGTATTACTTCTTGTTAA[C/G]
AAGGCCTGAACCTGTATAAAATTCCTTGTCTCTCAACCCATCCACTTTTCTAGCTTGATAGCCACCCCCTTTTAGTATTGCCGAAATCTTGTTTCAACAG
CTGTTGAAACAAGATTTCGGCAATACTAAAAGGGGGTGGCTATCAAGCTAGAAAAGTGGATGGGTTGAGAGACAAGGAATTTTATACAGGTTCAGGCCTT[G/C]
TTAACAAGAAGTAATACCCTACTCCTGTCCGGGGATTGATCCGCCGAGTATGTTATTGATCGTATGATCTGGGAGAAAATCGTGCCCCAAGAGGCACCCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.10% | 15.20% | 0.40% | 45.26% | NA |
| All Indica | 2759 | 49.90% | 1.20% | 0.51% | 48.39% | NA |
| All Japonica | 1512 | 12.40% | 44.80% | 0.13% | 42.66% | NA |
| Aus | 269 | 86.20% | 0.40% | 0.00% | 13.38% | NA |
| Indica I | 595 | 34.30% | 2.20% | 0.34% | 63.19% | NA |
| Indica II | 465 | 51.20% | 0.90% | 0.22% | 47.74% | NA |
| Indica III | 913 | 58.50% | 0.20% | 0.44% | 40.85% | NA |
| Indica Intermediate | 786 | 51.10% | 1.70% | 0.89% | 46.31% | NA |
| Temperate Japonica | 767 | 2.10% | 83.10% | 0.00% | 14.86% | NA |
| Tropical Japonica | 504 | 29.20% | 1.00% | 0.40% | 69.44% | NA |
| Japonica Intermediate | 241 | 10.40% | 14.50% | 0.00% | 75.10% | NA |
| VI/Aromatic | 96 | 8.30% | 0.00% | 3.12% | 88.54% | NA |
| Intermediate | 90 | 46.70% | 11.10% | 0.00% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117089560 | C -> DEL | N | N | silent_mutation | Average:26.422; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg1117089560 | C -> G | LOC_Os11g29430.1 | upstream_gene_variant ; 550.0bp to feature; MODIFIER | silent_mutation | Average:26.422; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg1117089560 | C -> G | LOC_Os11g29440.1 | downstream_gene_variant ; 418.0bp to feature; MODIFIER | silent_mutation | Average:26.422; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg1117089560 | C -> G | LOC_Os11g29450.1 | downstream_gene_variant ; 2989.0bp to feature; MODIFIER | silent_mutation | Average:26.422; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg1117089560 | C -> G | LOC_Os11g29430-LOC_Os11g29440 | intergenic_region ; MODIFIER | silent_mutation | Average:26.422; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117089560 | NA | 1.98E-07 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117089560 | NA | 5.20E-07 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117089560 | NA | 6.55E-10 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117089560 | NA | 1.36E-06 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117089560 | 3.10E-06 | 2.04E-06 | mr1707_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |