Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117089560:

Variant ID: vg1117089560 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17089560
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, C: 0.17, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

CGGGTGCCTCTTGGGGCACGATTTTCTCCCAGATCATACGATCAATAACATACTCGGCGGATCAATCCCCGGACAGGAGTAGGGTATTACTTCTTGTTAA[C/G]
AAGGCCTGAACCTGTATAAAATTCCTTGTCTCTCAACCCATCCACTTTTCTAGCTTGATAGCCACCCCCTTTTAGTATTGCCGAAATCTTGTTTCAACAG

Reverse complement sequence

CTGTTGAAACAAGATTTCGGCAATACTAAAAGGGGGTGGCTATCAAGCTAGAAAAGTGGATGGGTTGAGAGACAAGGAATTTTATACAGGTTCAGGCCTT[G/C]
TTAACAAGAAGTAATACCCTACTCCTGTCCGGGGATTGATCCGCCGAGTATGTTATTGATCGTATGATCTGGGAGAAAATCGTGCCCCAAGAGGCACCCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.10%	15.20%	0.40%	45.26%	NA
All Indica	2759	49.90%	1.20%	0.51%	48.39%	NA
All Japonica	1512	12.40%	44.80%	0.13%	42.66%	NA
Aus	269	86.20%	0.40%	0.00%	13.38%	NA
Indica I	595	34.30%	2.20%	0.34%	63.19%	NA
Indica II	465	51.20%	0.90%	0.22%	47.74%	NA
Indica III	913	58.50%	0.20%	0.44%	40.85%	NA
Indica Intermediate	786	51.10%	1.70%	0.89%	46.31%	NA
Temperate Japonica	767	2.10%	83.10%	0.00%	14.86%	NA
Tropical Japonica	504	29.20%	1.00%	0.40%	69.44%	NA
Japonica Intermediate	241	10.40%	14.50%	0.00%	75.10%	NA
VI/Aromatic	96	8.30%	0.00%	3.12%	88.54%	NA
Intermediate	90	46.70%	11.10%	0.00%	42.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117089560	C -> DEL	N	N	silent_mutation	Average:26.422; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg1117089560	C -> G	LOC_Os11g29430.1	upstream_gene_variant ; 550.0bp to feature; MODIFIER	silent_mutation	Average:26.422; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg1117089560	C -> G	LOC_Os11g29440.1	downstream_gene_variant ; 418.0bp to feature; MODIFIER	silent_mutation	Average:26.422; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg1117089560	C -> G	LOC_Os11g29450.1	downstream_gene_variant ; 2989.0bp to feature; MODIFIER	silent_mutation	Average:26.422; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg1117089560	C -> G	LOC_Os11g29430-LOC_Os11g29440	intergenic_region ; MODIFIER	silent_mutation	Average:26.422; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117089560	NA	1.98E-07	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117089560	NA	5.20E-07	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117089560	NA	6.55E-10	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117089560	NA	1.36E-06	mr1629_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117089560	3.10E-06	2.04E-06	mr1707_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251