\
| Variant ID: vg1117079321 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17079321 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.21, others allele: 0.00, population size: 85. )
AGCAGCAAATAACCACGTTTAGAGAAAGTTTTCCCCAAGAGTGAGTTTATGGTATCCTATAGCTAAAACCATAGAGTCGCGATGTTATGTAGCAAAATTT[G/A]
CCTATAGTCATAGGTTCATATTACATATTGTCCCATACAACGTTACGTGATAAGGAAATTAAAAAAGCAACTCAAGTACATTTACGGTACGATCAATTCA
TGAATTGATCGTACCGTAAATGTACTTGAGTTGCTTTTTTAATTTCCTTATCACGTAACGTTGTATGGGACAATATGTAATATGAACCTATGACTATAGG[C/T]
AAATTTTGCTACATAACATCGCGACTCTATGGTTTTAGCTATAGGATACCATAAACTCACTCTTGGGGAAAACTTTCTCTAAACGTGGTTATTTGCTGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.00% | 25.70% | 1.21% | 43.08% | NA |
| All Indica | 2759 | 18.60% | 34.10% | 1.41% | 45.92% | NA |
| All Japonica | 1512 | 45.80% | 12.60% | 0.79% | 40.87% | NA |
| Aus | 269 | 68.80% | 18.60% | 1.12% | 11.52% | NA |
| Indica I | 595 | 12.60% | 27.90% | 1.85% | 57.65% | NA |
| Indica II | 465 | 19.60% | 33.80% | 1.08% | 45.59% | NA |
| Indica III | 913 | 20.00% | 39.00% | 0.22% | 40.74% | NA |
| Indica Intermediate | 786 | 20.70% | 33.30% | 2.67% | 43.26% | NA |
| Temperate Japonica | 767 | 83.60% | 2.50% | 0.26% | 13.69% | NA |
| Tropical Japonica | 504 | 2.00% | 29.40% | 1.59% | 67.06% | NA |
| Japonica Intermediate | 241 | 17.00% | 9.50% | 0.83% | 72.61% | NA |
| VI/Aromatic | 96 | 5.20% | 2.10% | 3.12% | 89.58% | NA |
| Intermediate | 90 | 27.80% | 34.40% | 0.00% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117079321 | G -> A | LOC_Os11g29410.1 | upstream_gene_variant ; 230.0bp to feature; MODIFIER | silent_mutation | Average:36.14; most accessible tissue: Callus, score: 63.408 | N | N | N | N |
| vg1117079321 | G -> A | LOC_Os11g29420.1 | downstream_gene_variant ; 902.0bp to feature; MODIFIER | silent_mutation | Average:36.14; most accessible tissue: Callus, score: 63.408 | N | N | N | N |
| vg1117079321 | G -> A | LOC_Os11g29410-LOC_Os11g29420 | intergenic_region ; MODIFIER | silent_mutation | Average:36.14; most accessible tissue: Callus, score: 63.408 | N | N | N | N |
| vg1117079321 | G -> DEL | N | N | silent_mutation | Average:36.14; most accessible tissue: Callus, score: 63.408 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117079321 | NA | 1.21E-08 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117079321 | NA | 4.21E-07 | mr1378 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117079321 | 7.83E-07 | 6.22E-10 | mr1380 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117079321 | 6.97E-07 | 3.15E-08 | mr1380 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117079321 | NA | 3.72E-06 | mr1428 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117079321 | NA | 2.28E-06 | mr1520 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117079321 | NA | 3.49E-09 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117079321 | 1.79E-06 | 3.86E-08 | mr1561 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117079321 | NA | 7.31E-06 | mr1579 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117079321 | NA | 1.89E-06 | mr1740 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117079321 | NA | 7.04E-07 | mr1875 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117079321 | NA | 1.87E-06 | mr1908 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117079321 | NA | 5.01E-08 | mr1937 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117079321 | NA | 6.22E-07 | mr1937 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117079321 | NA | 7.58E-06 | mr1943 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117079321 | NA | 9.93E-08 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |