\
| Variant ID: vg1116968421 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16968421 |
| Reference Allele: A | Alternative Allele: G,C |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCAAATAATTAGAAAGAAAGACTAACACTAGACTATACGTTTAGATTATCAGGGTGATGCCCGGCTGTTTGCGAGTGCTTCTCCGTCAACACCCCCACTC[A/G,C]
CTCTTCCCAGTTTTAGAAATTTTAGATCTATTAGGTGGATTAGGGTTTGTCTTCTAGATTGTCCATGGACATGCAATTGCCTAGAGTATTTTAGTTTTTC
GAAAAACTAAAATACTCTAGGCAATTGCATGTCCATGGACAATCTAGAAGACAAACCCTAATCCACCTAATAGATCTAAAATTTCTAAAACTGGGAAGAG[T/C,G]
GAGTGGGGGTGTTGACGGAGAAGCACTCGCAAACAGCCGGGCATCACCCTGATAATCTAAACGTATAGTCTAGTGTTAGTCTTTCTTTCTAATTATTTGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.40% | 6.00% | 1.50% | 0.00% | C: 0.11% |
| All Indica | 2759 | 99.20% | 0.10% | 0.51% | 0.00% | C: 0.11% |
| All Japonica | 1512 | 78.60% | 18.10% | 3.31% | 0.00% | NA |
| Aus | 269 | 97.00% | 0.00% | 2.23% | 0.00% | C: 0.74% |
| Indica I | 595 | 98.70% | 0.00% | 1.34% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.11% | 0.00% | C: 0.11% |
| Indica Intermediate | 786 | 98.60% | 0.50% | 0.64% | 0.00% | C: 0.25% |
| Temperate Japonica | 767 | 97.70% | 0.70% | 1.69% | 0.00% | NA |
| Tropical Japonica | 504 | 44.00% | 50.00% | 5.95% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.00% | 7.10% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116968421 | A -> G | LOC_Os11g29274.1 | upstream_gene_variant ; 3165.0bp to feature; MODIFIER | silent_mutation | Average:54.511; most accessible tissue: Zhenshan97 flower, score: 74.205 | N | N | N | N |
| vg1116968421 | A -> G | LOC_Os11g29260.1 | downstream_gene_variant ; 1337.0bp to feature; MODIFIER | silent_mutation | Average:54.511; most accessible tissue: Zhenshan97 flower, score: 74.205 | N | N | N | N |
| vg1116968421 | A -> G | LOC_Os11g29250-LOC_Os11g29260 | intergenic_region ; MODIFIER | silent_mutation | Average:54.511; most accessible tissue: Zhenshan97 flower, score: 74.205 | N | N | N | N |
| vg1116968421 | A -> C | LOC_Os11g29274.1 | upstream_gene_variant ; 3165.0bp to feature; MODIFIER | silent_mutation | Average:54.511; most accessible tissue: Zhenshan97 flower, score: 74.205 | N | N | N | N |
| vg1116968421 | A -> C | LOC_Os11g29260.1 | downstream_gene_variant ; 1337.0bp to feature; MODIFIER | silent_mutation | Average:54.511; most accessible tissue: Zhenshan97 flower, score: 74.205 | N | N | N | N |
| vg1116968421 | A -> C | LOC_Os11g29250-LOC_Os11g29260 | intergenic_region ; MODIFIER | silent_mutation | Average:54.511; most accessible tissue: Zhenshan97 flower, score: 74.205 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116968421 | NA | 6.03E-11 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116968421 | NA | 8.50E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116968421 | NA | 1.83E-09 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116968421 | NA | 3.73E-06 | mr1742 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116968421 | 6.09E-06 | 6.57E-08 | mr1800 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116968421 | NA | 5.71E-11 | mr1800 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116968421 | 1.58E-06 | NA | mr1862 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116968421 | NA | 3.48E-09 | mr1862 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116968421 | NA | 2.76E-07 | mr1401_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116968421 | NA | 7.46E-09 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116968421 | NA | 1.48E-08 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116968421 | NA | 1.37E-06 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |