\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116968421:

Variant ID: vg1116968421 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16968421
Reference Allele: AAlternative Allele: G,C
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAAATAATTAGAAAGAAAGACTAACACTAGACTATACGTTTAGATTATCAGGGTGATGCCCGGCTGTTTGCGAGTGCTTCTCCGTCAACACCCCCACTC[A/G,C]
CTCTTCCCAGTTTTAGAAATTTTAGATCTATTAGGTGGATTAGGGTTTGTCTTCTAGATTGTCCATGGACATGCAATTGCCTAGAGTATTTTAGTTTTTC

Reverse complement sequence

GAAAAACTAAAATACTCTAGGCAATTGCATGTCCATGGACAATCTAGAAGACAAACCCTAATCCACCTAATAGATCTAAAATTTCTAAAACTGGGAAGAG[T/C,G]
GAGTGGGGGTGTTGACGGAGAAGCACTCGCAAACAGCCGGGCATCACCCTGATAATCTAAACGTATAGTCTAGTGTTAGTCTTTCTTTCTAATTATTTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 6.00% 1.50% 0.00% C: 0.11%
All Indica  2759 99.20% 0.10% 0.51% 0.00% C: 0.11%
All Japonica  1512 78.60% 18.10% 3.31% 0.00% NA
Aus  269 97.00% 0.00% 2.23% 0.00% C: 0.74%
Indica I  595 98.70% 0.00% 1.34% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.00% 0.11% 0.00% C: 0.11%
Indica Intermediate  786 98.60% 0.50% 0.64% 0.00% C: 0.25%
Temperate Japonica  767 97.70% 0.70% 1.69% 0.00% NA
Tropical Japonica  504 44.00% 50.00% 5.95% 0.00% NA
Japonica Intermediate  241 90.00% 7.10% 2.90% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1116968421 A -> G LOC_Os11g29274.1 upstream_gene_variant ; 3165.0bp to feature; MODIFIER silent_mutation Average:54.511; most accessible tissue: Zhenshan97 flower, score: 74.205 N N N N
vg1116968421 A -> G LOC_Os11g29260.1 downstream_gene_variant ; 1337.0bp to feature; MODIFIER silent_mutation Average:54.511; most accessible tissue: Zhenshan97 flower, score: 74.205 N N N N
vg1116968421 A -> G LOC_Os11g29250-LOC_Os11g29260 intergenic_region ; MODIFIER silent_mutation Average:54.511; most accessible tissue: Zhenshan97 flower, score: 74.205 N N N N
vg1116968421 A -> C LOC_Os11g29274.1 upstream_gene_variant ; 3165.0bp to feature; MODIFIER silent_mutation Average:54.511; most accessible tissue: Zhenshan97 flower, score: 74.205 N N N N
vg1116968421 A -> C LOC_Os11g29260.1 downstream_gene_variant ; 1337.0bp to feature; MODIFIER silent_mutation Average:54.511; most accessible tissue: Zhenshan97 flower, score: 74.205 N N N N
vg1116968421 A -> C LOC_Os11g29250-LOC_Os11g29260 intergenic_region ; MODIFIER silent_mutation Average:54.511; most accessible tissue: Zhenshan97 flower, score: 74.205 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1116968421 NA 6.03E-11 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116968421 NA 8.50E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116968421 NA 1.83E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116968421 NA 3.73E-06 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116968421 6.09E-06 6.57E-08 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116968421 NA 5.71E-11 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116968421 1.58E-06 NA mr1862 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116968421 NA 3.48E-09 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116968421 NA 2.76E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116968421 NA 7.46E-09 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116968421 NA 1.48E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116968421 NA 1.37E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251