\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116956482:

Variant ID: vg1116956482 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16956482
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCTTTGGTTTTTTTTTGTCAATTTTTTTCGCCGGTTTTTTTTCTCCTATGCGCCTTTTGTTTTTCTCATCCGGTTTTTTAATCTGATCTGTTCGCCGCA[T/C]
GCCTTCCCACTTTAACCTAGCGCCACGTCGCCGCCATATTGATCGTGCGTTTTCTCCAATTTGATTGAAAAATCGATTCCTCATTCATCTCTCATCATTT

Reverse complement sequence

AAATGATGAGAGATGAATGAGGAATCGATTTTTCAATCAAATTGGAGAAAACGCACGATCAATATGGCGGCGACGTGGCGCTAGGTTAAAGTGGGAAGGC[A/G]
TGCGGCGAACAGATCAGATTAAAAAACCGGATGAGAAAAACAAAAGGCGCATAGGAGAAAAAAAACCGGCGAAAAAAATTGACAAAAAAAAACCAAAGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.20% 39.80% 0.00% 0.00% NA
All Indica  2759 90.70% 9.30% 0.00% 0.00% NA
All Japonica  1512 5.70% 94.30% 0.00% 0.00% NA
Aus  269 73.20% 26.80% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 95.30% 4.70% 0.00% 0.00% NA
Indica III  913 81.40% 18.60% 0.00% 0.00% NA
Indica Intermediate  786 92.20% 7.80% 0.00% 0.00% NA
Temperate Japonica  767 4.00% 96.00% 0.00% 0.00% NA
Tropical Japonica  504 5.60% 94.40% 0.00% 0.00% NA
Japonica Intermediate  241 11.20% 88.80% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 57.80% 42.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1116956482 T -> C LOC_Os11g29240.1 upstream_gene_variant ; 2643.0bp to feature; MODIFIER silent_mutation Average:56.314; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg1116956482 T -> C LOC_Os11g29250.1 downstream_gene_variant ; 1161.0bp to feature; MODIFIER silent_mutation Average:56.314; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg1116956482 T -> C LOC_Os11g29240-LOC_Os11g29250 intergenic_region ; MODIFIER silent_mutation Average:56.314; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1116956482 4.08E-06 4.26E-79 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116956482 NA 3.45E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116956482 NA 2.67E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116956482 NA 2.67E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116956482 NA 1.16E-09 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116956482 NA 4.41E-87 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116956482 NA 7.90E-87 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116956482 NA 2.44E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116956482 NA 3.21E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116956482 NA 1.58E-10 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116956482 NA 9.99E-37 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116956482 NA 1.06E-11 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116956482 NA 1.49E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116956482 NA 5.02E-36 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116956482 NA 3.11E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116956482 NA 3.42E-40 mr1888_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251