| Variant ID: vg1116955967 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16955967 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGATATAGTCTACGAAATACTAATTTGACCAACCATACATTTCTATCTCTACTATTATAAAAATTAAAGATGTTTTTACCGGTATTTTGGTACGTCATTC[A/G]
TGTTTGAATCGGTTTTAATTTTATGCTTCCATTTTAATCTATATCTCTACTTAAAAAAAGAAATTTCTGTCGTTGTAGAAAAGAAAGAAAAAGGTCTGAC
GTCAGACCTTTTTCTTTCTTTTCTACAACGACAGAAATTTCTTTTTTTAAGTAGAGATATAGATTAAAATGGAAGCATAAAATTAAAACCGATTCAAACA[T/C]
GAATGACGTACCAAAATACCGGTAAAAACATCTTTAATTTTTATAATAGTAGAGATAGAAATGTATGGTTGGTCAAATTAGTATTTCGTAGACTATATCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.40% | 40.20% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 89.40% | 10.00% | 0.65% | 0.00% | NA |
| All Japonica | 1512 | 7.50% | 92.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 63.90% | 36.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.60% | 12.10% | 0.34% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 87.30% | 12.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.80% | 10.20% | 2.04% | 0.00% | NA |
| Temperate Japonica | 767 | 3.40% | 96.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 12.00% | 88.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 44.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116955967 | A -> G | LOC_Os11g29240.1 | upstream_gene_variant ; 2128.0bp to feature; MODIFIER | silent_mutation | Average:80.33; most accessible tissue: Callus, score: 91.785 | N | N | N | N |
| vg1116955967 | A -> G | LOC_Os11g29250.1 | downstream_gene_variant ; 1676.0bp to feature; MODIFIER | silent_mutation | Average:80.33; most accessible tissue: Callus, score: 91.785 | N | N | N | N |
| vg1116955967 | A -> G | LOC_Os11g29240-LOC_Os11g29250 | intergenic_region ; MODIFIER | silent_mutation | Average:80.33; most accessible tissue: Callus, score: 91.785 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116955967 | NA | 3.03E-06 | mr1179 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116955967 | NA | 5.80E-14 | mr1218 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116955967 | NA | 6.87E-14 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116955967 | NA | 6.87E-14 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116955967 | NA | 4.35E-08 | mr1624 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116955967 | NA | 1.65E-11 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116955967 | NA | 3.55E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116955967 | NA | 3.10E-07 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116955967 | NA | 1.26E-07 | mr1758_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |