\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116933705:

Variant ID: vg1116933705 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16933705
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTTTTATACAACATAAAATTTTCATTCACTTACTAACACATTGGGTTGATATATATATACTTTTAAGAAATCCATTATATGCCATTGATGAAGCCCCTT[A/G]
TCTATGTAGTATACCATCAACAAAGCCTCATTATTCGTGTGTAGTGACTTTCAAAAGTTATTTCCTATATTGGGCTACTGGAATTGAGATAAATCTAAGA

Reverse complement sequence

TCTTAGATTTATCTCAATTCCAGTAGCCCAATATAGGAAATAACTTTTGAAAGTCACTACACACGAATAATGAGGCTTTGTTGATGGTATACTACATAGA[T/C]
AAGGGGCTTCATCAATGGCATATAATGGATTTCTTAAAAGTATATATATATCAACCCAATGTGTTAGTAAGTGAATGAAAATTTTATGTTGTATAAAACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 40.00% 0.11% 0.00% NA
All Indica  2759 89.00% 10.80% 0.18% 0.00% NA
All Japonica  1512 7.30% 92.70% 0.00% 0.00% NA
Aus  269 76.20% 23.80% 0.00% 0.00% NA
Indica I  595 87.10% 12.80% 0.17% 0.00% NA
Indica II  465 91.60% 8.20% 0.22% 0.00% NA
Indica III  913 91.20% 8.70% 0.11% 0.00% NA
Indica Intermediate  786 86.40% 13.40% 0.25% 0.00% NA
Temperate Japonica  767 3.50% 96.50% 0.00% 0.00% NA
Tropical Japonica  504 11.30% 88.70% 0.00% 0.00% NA
Japonica Intermediate  241 11.20% 88.80% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 57.80% 42.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1116933705 A -> G LOC_Os11g29210.1 downstream_gene_variant ; 3803.0bp to feature; MODIFIER silent_mutation Average:42.774; most accessible tissue: Callus, score: 70.938 N N N N
vg1116933705 A -> G LOC_Os11g29210.2 downstream_gene_variant ; 3787.0bp to feature; MODIFIER silent_mutation Average:42.774; most accessible tissue: Callus, score: 70.938 N N N N
vg1116933705 A -> G LOC_Os11g29200.1 intron_variant ; MODIFIER silent_mutation Average:42.774; most accessible tissue: Callus, score: 70.938 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1116933705 NA 3.68E-07 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933705 9.05E-06 9.05E-06 mr1337 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933705 4.47E-07 4.47E-07 mr1572 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933705 5.10E-06 6.17E-06 mr1582 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933705 NA 7.69E-06 mr1209_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933705 3.70E-06 NA mr1359_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933705 NA 5.56E-06 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933705 9.59E-06 1.21E-09 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933705 8.40E-06 6.50E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933705 NA 5.71E-10 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933705 7.77E-06 4.67E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933705 6.16E-06 NA mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933705 4.17E-06 2.53E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933705 NA 2.87E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933705 NA 2.11E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933705 4.64E-06 NA mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933705 2.76E-06 7.44E-07 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933705 5.85E-06 NA mr1960_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251