\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116906166:

Variant ID: vg1116906166 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16906166
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGCAAAAACTCAAGATCGGTAAAGATCGAAAAGAGCAAACGTGGCTCTGATACCACTGGTAGGATCGAATCACAAGAACTAAGCCAACCAGAGGGGGG[G/A,T]
TGAATGGTTGGTATACCCAAAAACCAAAAACTTTTAGCGGAAATAAAAGTTACCCTCGAAATCGATGGATCGCGGTCTGACTAAAGTAGTTGCACCAGTC

Reverse complement sequence

GACTGGTGCAACTACTTTAGTCAGACCGCGATCCATCGATTTCGAGGGTAACTTTTATTTCCGCTAAAAGTTTTTGGTTTTTGGGTATACCAACCATTCA[C/T,A]
CCCCCCTCTGGTTGGCTTAGTTCTTGTGATTCGATCCTACCAGTGGTATCAGAGCCACGTTTGCTCTTTTCGATCTTTACCGATCTTGAGTTTTTGCCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.90% 17.00% 0.08% 0.04% NA
All Indica  2759 73.60% 26.20% 0.11% 0.07% NA
All Japonica  1512 96.20% 3.80% 0.00% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 90.60% 9.40% 0.00% 0.00% NA
Indica II  465 59.10% 40.40% 0.43% 0.00% NA
Indica III  913 72.90% 26.80% 0.11% 0.11% NA
Indica Intermediate  786 70.10% 29.80% 0.00% 0.13% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 90.90% 9.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1116906166 G -> T LOC_Os11g29160.1 upstream_gene_variant ; 99.0bp to feature; MODIFIER N Average:19.337; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N
vg1116906166 G -> T LOC_Os11g29170.1 upstream_gene_variant ; 2588.0bp to feature; MODIFIER N Average:19.337; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N
vg1116906166 G -> T LOC_Os11g29160-LOC_Os11g29170 intergenic_region ; MODIFIER N Average:19.337; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N
vg1116906166 G -> A LOC_Os11g29160.1 upstream_gene_variant ; 99.0bp to feature; MODIFIER silent_mutation Average:19.337; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N
vg1116906166 G -> A LOC_Os11g29170.1 upstream_gene_variant ; 2588.0bp to feature; MODIFIER silent_mutation Average:19.337; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N
vg1116906166 G -> A LOC_Os11g29160-LOC_Os11g29170 intergenic_region ; MODIFIER silent_mutation Average:19.337; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N
vg1116906166 G -> DEL N N silent_mutation Average:19.337; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1116906166 1.09E-07 NA mr1144 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116906166 2.41E-07 7.18E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116906166 9.61E-06 NA mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251