\
| Variant ID: vg1116856270 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16856270 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, A: 0.17, others allele: 0.00, population size: 92. )
TTATAGTAAAAACTAAATGTCACAGTCATGTTTGCTCCTAAGTCCCAAGCAAAGTATACATAAAGATTGTATTCTTGGTACTGCACAAGGATAGGAAGAA[T/A]
TCTGTCAAGCCGTCAGCTGTTAGCTTTGATTTTCACTGATAAAAATGAGTTGTCTTGCTTAAAACATTTGCTGACCCAGCTGCAGACATTTAAGCAGCTG
CAGCTGCTTAAATGTCTGCAGCTGGGTCAGCAAATGTTTTAAGCAAGACAACTCATTTTTATCAGTGAAAATCAAAGCTAACAGCTGACGGCTTGACAGA[A/T]
TTCTTCCTATCCTTGTGCAGTACCAAGAATACAATCTTTATGTATACTTTGCTTGGGACTTAGGAGCAAACATGACTGTGACATTTAGTTTTTACTATAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.40% | 23.70% | 0.28% | 27.61% | NA |
| All Indica | 2759 | 51.00% | 7.60% | 0.43% | 40.88% | NA |
| All Japonica | 1512 | 44.60% | 49.00% | 0.00% | 6.42% | NA |
| Aus | 269 | 60.20% | 19.70% | 0.00% | 20.07% | NA |
| Indica I | 595 | 74.30% | 5.90% | 0.34% | 19.50% | NA |
| Indica II | 465 | 34.00% | 17.40% | 0.86% | 47.74% | NA |
| Indica III | 913 | 45.20% | 1.60% | 0.22% | 52.90% | NA |
| Indica Intermediate | 786 | 50.30% | 10.20% | 0.51% | 39.06% | NA |
| Temperate Japonica | 767 | 14.60% | 83.20% | 0.00% | 2.22% | NA |
| Tropical Japonica | 504 | 80.20% | 9.30% | 0.00% | 10.52% | NA |
| Japonica Intermediate | 241 | 65.60% | 23.20% | 0.00% | 11.20% | NA |
| VI/Aromatic | 96 | 6.20% | 90.60% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 41.10% | 32.20% | 1.11% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116856270 | T -> A | LOC_Os11g29090.1 | upstream_gene_variant ; 4043.0bp to feature; MODIFIER | silent_mutation | Average:24.761; most accessible tissue: Callus, score: 85.585 | N | N | N | N |
| vg1116856270 | T -> A | LOC_Os11g29100.1 | upstream_gene_variant ; 2497.0bp to feature; MODIFIER | silent_mutation | Average:24.761; most accessible tissue: Callus, score: 85.585 | N | N | N | N |
| vg1116856270 | T -> A | LOC_Os11g29110.1 | upstream_gene_variant ; 3965.0bp to feature; MODIFIER | silent_mutation | Average:24.761; most accessible tissue: Callus, score: 85.585 | N | N | N | N |
| vg1116856270 | T -> A | LOC_Os11g29090-LOC_Os11g29100 | intergenic_region ; MODIFIER | silent_mutation | Average:24.761; most accessible tissue: Callus, score: 85.585 | N | N | N | N |
| vg1116856270 | T -> DEL | N | N | silent_mutation | Average:24.761; most accessible tissue: Callus, score: 85.585 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116856270 | NA | 2.96E-09 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116856270 | NA | 3.15E-07 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116856270 | NA | 5.58E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116856270 | NA | 6.73E-09 | mr1827 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116856270 | NA | 5.45E-07 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116856270 | NA | 8.38E-06 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116856270 | NA | 5.82E-07 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116856270 | NA | 6.56E-10 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116856270 | 8.60E-07 | 2.45E-07 | mr1582_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116856270 | NA | 1.92E-08 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116856270 | NA | 1.62E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116856270 | NA | 5.98E-07 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116856270 | NA | 4.38E-08 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |