\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116856270:

Variant ID: vg1116856270 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16856270
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, A: 0.17, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TTATAGTAAAAACTAAATGTCACAGTCATGTTTGCTCCTAAGTCCCAAGCAAAGTATACATAAAGATTGTATTCTTGGTACTGCACAAGGATAGGAAGAA[T/A]
TCTGTCAAGCCGTCAGCTGTTAGCTTTGATTTTCACTGATAAAAATGAGTTGTCTTGCTTAAAACATTTGCTGACCCAGCTGCAGACATTTAAGCAGCTG

Reverse complement sequence

CAGCTGCTTAAATGTCTGCAGCTGGGTCAGCAAATGTTTTAAGCAAGACAACTCATTTTTATCAGTGAAAATCAAAGCTAACAGCTGACGGCTTGACAGA[A/T]
TTCTTCCTATCCTTGTGCAGTACCAAGAATACAATCTTTATGTATACTTTGCTTGGGACTTAGGAGCAAACATGACTGTGACATTTAGTTTTTACTATAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.40% 23.70% 0.28% 27.61% NA
All Indica  2759 51.00% 7.60% 0.43% 40.88% NA
All Japonica  1512 44.60% 49.00% 0.00% 6.42% NA
Aus  269 60.20% 19.70% 0.00% 20.07% NA
Indica I  595 74.30% 5.90% 0.34% 19.50% NA
Indica II  465 34.00% 17.40% 0.86% 47.74% NA
Indica III  913 45.20% 1.60% 0.22% 52.90% NA
Indica Intermediate  786 50.30% 10.20% 0.51% 39.06% NA
Temperate Japonica  767 14.60% 83.20% 0.00% 2.22% NA
Tropical Japonica  504 80.20% 9.30% 0.00% 10.52% NA
Japonica Intermediate  241 65.60% 23.20% 0.00% 11.20% NA
VI/Aromatic  96 6.20% 90.60% 0.00% 3.12% NA
Intermediate  90 41.10% 32.20% 1.11% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1116856270 T -> A LOC_Os11g29090.1 upstream_gene_variant ; 4043.0bp to feature; MODIFIER silent_mutation Average:24.761; most accessible tissue: Callus, score: 85.585 N N N N
vg1116856270 T -> A LOC_Os11g29100.1 upstream_gene_variant ; 2497.0bp to feature; MODIFIER silent_mutation Average:24.761; most accessible tissue: Callus, score: 85.585 N N N N
vg1116856270 T -> A LOC_Os11g29110.1 upstream_gene_variant ; 3965.0bp to feature; MODIFIER silent_mutation Average:24.761; most accessible tissue: Callus, score: 85.585 N N N N
vg1116856270 T -> A LOC_Os11g29090-LOC_Os11g29100 intergenic_region ; MODIFIER silent_mutation Average:24.761; most accessible tissue: Callus, score: 85.585 N N N N
vg1116856270 T -> DEL N N silent_mutation Average:24.761; most accessible tissue: Callus, score: 85.585 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1116856270 NA 2.96E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116856270 NA 3.15E-07 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116856270 NA 5.58E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116856270 NA 6.73E-09 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116856270 NA 5.45E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116856270 NA 8.38E-06 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116856270 NA 5.82E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116856270 NA 6.56E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116856270 8.60E-07 2.45E-07 mr1582_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116856270 NA 1.92E-08 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116856270 NA 1.62E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116856270 NA 5.98E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116856270 NA 4.38E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251