| Variant ID: vg1116832810 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16832810 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 89. )
ATCAGATTCAACAATACTAAGAAAACACCGACGCGTGGAAGGGGAGGGTGTTGCCATCGCTGCCGAACAGCCACCGCCGTCGCAGGGATGTAGGTATGCC[A/G]
GGCCGCCGTCATGTTGTTTTGAGAGAGAGAGGGGGGAGGAGAAATGATTTTAGGGTTAGGGTTTGGGATGTTGAACTTTTATATAGGTCGGGATCAATCA
TGATTGATCCCGACCTATATAAAAGTTCAACATCCCAAACCCTAACCCTAAAATCATTTCTCCTCCCCCCTCTCTCTCTCAAAACAACATGACGGCGGCC[T/C]
GGCATACCTACATCCCTGCGACGGCGGTGGCTGTTCGGCAGCGATGGCAACACCCTCCCCTTCCACGCGTCGGTGTTTTCTTAGTATTGTTGAATCTGAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.40% | 14.20% | 27.40% | 19.00% | NA |
| All Indica | 2759 | 29.50% | 0.60% | 40.12% | 29.79% | NA |
| All Japonica | 1512 | 50.80% | 42.30% | 3.44% | 3.51% | NA |
| Aus | 269 | 53.50% | 0.70% | 42.75% | 2.97% | NA |
| Indica I | 595 | 8.40% | 0.80% | 31.76% | 58.99% | NA |
| Indica II | 465 | 49.50% | 0.20% | 26.45% | 23.87% | NA |
| Indica III | 913 | 29.70% | 0.10% | 56.19% | 14.02% | NA |
| Indica Intermediate | 786 | 33.30% | 1.30% | 35.88% | 29.52% | NA |
| Temperate Japonica | 767 | 83.60% | 14.10% | 0.78% | 1.56% | NA |
| Tropical Japonica | 504 | 13.90% | 74.60% | 7.54% | 3.97% | NA |
| Japonica Intermediate | 241 | 23.70% | 64.30% | 3.32% | 8.71% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 3.12% | 2.08% | NA |
| Intermediate | 90 | 50.00% | 15.60% | 20.00% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116832810 | A -> DEL | N | N | silent_mutation | Average:14.976; most accessible tissue: Callus, score: 24.789 | N | N | N | N |
| vg1116832810 | A -> G | LOC_Os11g29060.1 | upstream_gene_variant ; 3577.0bp to feature; MODIFIER | silent_mutation | Average:14.976; most accessible tissue: Callus, score: 24.789 | N | N | N | N |
| vg1116832810 | A -> G | LOC_Os11g29050-LOC_Os11g29060 | intergenic_region ; MODIFIER | silent_mutation | Average:14.976; most accessible tissue: Callus, score: 24.789 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116832810 | NA | 8.63E-10 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116832810 | 7.72E-06 | 1.38E-09 | mr1530 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116832810 | NA | 2.24E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116832810 | NA | 3.13E-11 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116832810 | NA | 3.83E-10 | mr1552_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116832810 | NA | 1.42E-06 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |