\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116818450:

Variant ID: vg1116818450 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16818450
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TCGATGTCAGCGCCCGATTTCCCCAGCCCCAGATCGGGCGACCGATCCGTAGGCGCGTCCTTTTGCAAGAAAAATAATTACTACCTAATATTGGATACAA[T/C]
CTACCAGTATGGACACATTACTTATCCCTATTCTCTCTGTTGCTGCAATATGCCATCTTTAATAGGTGAAAGAATATCATTAAATAATAAGAAATTACAA

Reverse complement sequence

TTGTAATTTCTTATTATTTAATGATATTCTTTCACCTATTAAAGATGGCATATTGCAGCAACAGAGAGAATAGGGATAAGTAATGTGTCCATACTGGTAG[A/G]
TTGTATCCAATATTAGGTAGTAATTATTTTTCTTGCAAAAGGACGCGCCTACGGATCGGTCGCCCGATCTGGGGCTGGGGAAATCGGGCGCTGACATCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.80% 18.70% 0.17% 32.35% NA
All Indica  2759 55.20% 1.10% 0.14% 43.57% NA
All Japonica  1512 46.60% 47.30% 0.00% 6.15% NA
Aus  269 10.40% 11.50% 0.74% 77.32% NA
Indica I  595 79.30% 0.30% 0.00% 20.34% NA
Indica II  465 49.00% 0.60% 0.43% 49.89% NA
Indica III  913 43.20% 0.80% 0.22% 55.86% NA
Indica Intermediate  786 54.50% 2.40% 0.00% 43.13% NA
Temperate Japonica  767 16.00% 82.00% 0.00% 1.96% NA
Tropical Japonica  504 82.30% 7.30% 0.00% 10.32% NA
Japonica Intermediate  241 68.90% 20.30% 0.00% 10.79% NA
VI/Aromatic  96 3.10% 92.70% 1.04% 3.12% NA
Intermediate  90 52.20% 21.10% 1.11% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1116818450 T -> DEL N N silent_mutation Average:25.386; most accessible tissue: Callus, score: 60.647 N N N N
vg1116818450 T -> C LOC_Os11g29050.1 upstream_gene_variant ; 3129.0bp to feature; MODIFIER silent_mutation Average:25.386; most accessible tissue: Callus, score: 60.647 N N N N
vg1116818450 T -> C LOC_Os11g29030-LOC_Os11g29050 intergenic_region ; MODIFIER silent_mutation Average:25.386; most accessible tissue: Callus, score: 60.647 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1116818450 NA 4.73E-10 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116818450 NA 7.90E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116818450 6.70E-06 NA mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116818450 NA 1.13E-07 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116818450 NA 1.39E-08 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116818450 NA 7.87E-13 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116818450 NA 6.49E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116818450 NA 2.41E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116818450 NA 9.62E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116818450 NA 9.49E-15 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116818450 NA 2.41E-09 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116818450 2.07E-06 1.98E-14 mr1982 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116818450 NA 7.20E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251