\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116689982:

Variant ID: vg1116689982 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16689982
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCGACTGGATCTGATAATTCCGATGATGAAAAAACTGACACCGATTAATGTTATATTATAACAATGATTCTGATGATGAAGATGATGGAGGCACAATTT[G/A]
TACAATACTGATGAATTTATGCTATGCTTGATATTTCAAACTTAGCTCCTAATTTCTTAAAAGCTTTTGTCAAACCTTATTGAGCCTAAAACCCGCAAAA

Reverse complement sequence

TTTTGCGGGTTTTAGGCTCAATAAGGTTTGACAAAAGCTTTTAAGAAATTAGGAGCTAAGTTTGAAATATCAAGCATAGCATAAATTCATCAGTATTGTA[C/T]
AAATTGTGCCTCCATCATCTTCATCATCAGAATCATTGTTATAATATAACATTAATCGGTGTCAGTTTTTTCATCATCGGAATTATCAGATCCAGTCGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.70% 12.30% 2.01% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 56.30% 37.50% 6.15% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 85.90% 13.80% 0.26% 0.00% NA
Tropical Japonica  504 24.60% 61.30% 14.09% 0.00% NA
Japonica Intermediate  241 28.60% 63.10% 8.30% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1116689982 G -> A LOC_Os11g28800.1 upstream_gene_variant ; 304.0bp to feature; MODIFIER silent_mutation Average:21.56; most accessible tissue: Minghui63 flag leaf, score: 31.47 N N N N
vg1116689982 G -> A LOC_Os11g28790.1 downstream_gene_variant ; 160.0bp to feature; MODIFIER silent_mutation Average:21.56; most accessible tissue: Minghui63 flag leaf, score: 31.47 N N N N
vg1116689982 G -> A LOC_Os11g28810.1 downstream_gene_variant ; 1725.0bp to feature; MODIFIER silent_mutation Average:21.56; most accessible tissue: Minghui63 flag leaf, score: 31.47 N N N N
vg1116689982 G -> A LOC_Os11g28790-LOC_Os11g28800 intergenic_region ; MODIFIER silent_mutation Average:21.56; most accessible tissue: Minghui63 flag leaf, score: 31.47 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1116689982 NA 3.27E-13 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116689982 4.11E-06 NA mr1653_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116689982 NA 4.01E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116689982 NA 3.23E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116689982 NA 1.47E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251