\
| Variant ID: vg1116629534 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16629534 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AGGACAAGCTATATGCTCAGGGGCTTACTAGCTCAAACACAAGTATCATACCTTCAATTTGGACTTGTTCCGGATACATGCAACATGAATTCATGATCAT[A/G]
GGTCTATTTTCTATGCTCAAAGACTGGACCAATTATTATTCCCCGTAAGGGCTATCAACCGAATACTTGCGCCAGTCGGGATTCAATTATTATATTTATT
AATAAATATAATAATTGAATCCCGACTGGCGCAAGTATTCGGTTGATAGCCCTTACGGGGAATAATAATTGGTCCAGTCTTTGAGCATAGAAAATAGACC[T/C]
ATGATCATGAATTCATGTTGCATGTATCCGGAACAAGTCCAAATTGAAGGTATGATACTTGTGTTTGAGCTAGTAAGCCCCTGAGCATATAGCTTGTCCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.80% | 9.60% | 49.41% | 7.26% | NA |
| All Indica | 2759 | 7.60% | 10.90% | 73.72% | 7.68% | NA |
| All Japonica | 1512 | 80.60% | 6.50% | 4.76% | 8.20% | NA |
| Aus | 269 | 15.20% | 15.60% | 69.14% | 0.00% | NA |
| Indica I | 595 | 4.00% | 19.70% | 59.83% | 16.47% | NA |
| Indica II | 465 | 5.60% | 2.60% | 81.72% | 10.11% | NA |
| Indica III | 913 | 9.10% | 8.10% | 80.94% | 1.86% | NA |
| Indica Intermediate | 786 | 9.90% | 12.60% | 71.12% | 6.36% | NA |
| Temperate Japonica | 767 | 91.00% | 0.10% | 3.78% | 5.08% | NA |
| Tropical Japonica | 504 | 66.90% | 17.50% | 4.76% | 10.91% | NA |
| Japonica Intermediate | 241 | 75.90% | 3.70% | 7.88% | 12.45% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 5.21% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 11.10% | 42.22% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116629534 | A -> DEL | N | N | silent_mutation | Average:28.13; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| vg1116629534 | A -> G | LOC_Os11g28730-LOC_Os11g28740 | intergenic_region ; MODIFIER | silent_mutation | Average:28.13; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116629534 | 5.53E-06 | 4.94E-79 | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116629534 | NA | 2.89E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116629534 | 3.29E-06 | 3.11E-88 | mr1504 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116629534 | NA | 2.64E-08 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116629534 | NA | 3.14E-11 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116629534 | NA | 1.56E-83 | mr1672 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116629534 | NA | 1.23E-93 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116629534 | NA | 6.51E-13 | mr1924 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116629534 | NA | 8.97E-06 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116629534 | NA | 1.08E-06 | mr1758_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116629534 | 7.24E-06 | NA | mr1795_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116629534 | 1.63E-09 | 2.86E-10 | mr1795_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116629534 | NA | 2.03E-06 | mr1888_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116629534 | NA | 6.64E-07 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116629534 | 4.48E-07 | 9.08E-07 | mr1962_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |