Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116613245:

Variant ID: vg1116613245 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 16613245
Reference Allele: T	Alternative Allele: C,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

CAATCCAACTGGACAGACAGGTTCTCGCAAGAGAAAACTGGTGCTCGACAACGATGAAGGCGACGACGATAAATCTGGGGACAAGGGCTCGCCTAATAAA[T/C,A]
TCCCAAAGCGTACCATGCCCAAGAAAAAACTGGCTGGCCGTCAAATGCTAAAGATTAGAACATCTTCCAGGTATAAACCTCTCGGTACCATCTCCCTTTG

Reverse complement sequence

CAAAGGGAGATGGTACCGAGAGGTTTATACCTGGAAGATGTTCTAATCTTTAGCATTTGACGGCCAGCCAGTTTTTTCTTGGGCATGGTACGCTTTGGGA[A/G,T]
TTTATTAGGCGAGCCCTTGTCCCCAGATTTATCGTCGTCGCCTTCATCGTTGTCGAGCACCAGTTTTCTCTTGCGAGAACCTGTCTGTCCAGTTGGATTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.00%	7.60%	53.09%	14.03%	A: 1.25%
All Indica	2759	7.00%	5.00%	62.56%	23.45%	A: 1.92%
All Japonica	1512	52.00%	11.90%	35.38%	0.33%	A: 0.40%
Aus	269	15.20%	13.00%	70.26%	1.49%	NA
Indica I	595	7.60%	2.20%	45.88%	44.20%	A: 0.17%
Indica II	465	4.50%	2.40%	58.49%	31.61%	A: 3.01%
Indica III	913	5.50%	8.70%	74.26%	8.87%	A: 2.74%
Indica Intermediate	786	9.90%	4.60%	63.99%	19.85%	A: 1.65%
Temperate Japonica	767	86.70%	0.80%	11.99%	0.52%	NA
Tropical Japonica	504	10.70%	22.80%	65.48%	0.00%	A: 0.99%
Japonica Intermediate	241	27.80%	24.50%	46.89%	0.41%	A: 0.41%
VI/Aromatic	96	93.80%	0.00%	6.25%	0.00%	NA
Intermediate	90	25.60%	7.80%	58.89%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1116613245	T -> A	LOC_Os11g28720.1	missense_variant ; p.Phe368Ile; MODERATE	nonsynonymous_codon ; F368T	Average:13.238; most accessible tissue: Minghui63 panicle, score: 25.313	benign	1.177	TOLERATED	0.23
vg1116613245	T -> DEL	LOC_Os11g28720.1	N	frameshift_variant	Average:13.238; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg1116613245	T -> C	LOC_Os11g28720.1	missense_variant ; p.Phe368Leu; MODERATE	nonsynonymous_codon ; F368P	Average:13.238; most accessible tissue: Minghui63 panicle, score: 25.313	benign	-0.141	TOLERATED	0.29
vg1116613245	T -> C	LOC_Os11g28720.1	missense_variant ; p.Phe368Leu; MODERATE	nonsynonymous_codon ; F368L	Average:13.238; most accessible tissue: Minghui63 panicle, score: 25.313	benign	-0.226	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1116613245	NA	7.79E-07	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	NA	1.51E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	NA	5.57E-08	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	NA	1.85E-06	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	NA	2.06E-07	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	NA	2.03E-06	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	9.18E-06	NA	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	7.28E-07	7.28E-07	mr1299	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	NA	7.76E-06	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	NA	2.55E-07	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	NA	1.23E-07	mr1639	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	NA	5.53E-07	mr1860	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	2.95E-06	2.95E-06	mr1881	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	3.64E-06	3.64E-06	mr1159_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	NA	8.03E-06	mr1267_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	2.43E-06	2.43E-06	mr1312_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	3.48E-06	3.48E-06	mr1663_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	5.38E-06	5.38E-06	mr1688_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	NA	5.49E-07	mr1812_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	1.55E-06	1.55E-06	mr1832_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	NA	1.89E-06	mr1833_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	9.38E-07	9.38E-07	mr1843_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116613245	3.59E-06	3.59E-06	mr1847_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251