\
| Variant ID: vg1116610872 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16610872 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAACATATGCCCCTAGAGGCACCCGGACCCCCCTTATATATGGGAAGGAGTCCGTGTTACAAAAGATAATCTATATCCCTAACGGAATATACAAATACAG[G/A]
TAAAATACAGTCGTAACCGACTAAGTCTCAAGGTGTTTCCTTGATGTACAAGTTAAGAAACAAACCCGAGATACAAATAAGATATTCTATATATATTCGG
CCGAATATATATAGAATATCTTATTTGTATCTCGGGTTTGTTTCTTAACTTGTACATCAAGGAAACACCTTGAGACTTAGTCGGTTACGACTGTATTTTA[C/T]
CTGTATTTGTATATTCCGTTAGGGATATAGATTATCTTTTGTAACACGGACTCCTTCCCATATATAAGGGGGGTCCGGGTGCCTCTAGGGGCATATGTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.00% | 0.50% | 11.07% | 49.37% | NA |
| All Indica | 2759 | 11.30% | 0.80% | 16.17% | 71.73% | NA |
| All Japonica | 1512 | 85.90% | 0.20% | 0.73% | 13.16% | NA |
| Aus | 269 | 33.10% | 0.00% | 22.30% | 44.61% | NA |
| Indica I | 595 | 14.10% | 0.50% | 11.26% | 74.12% | NA |
| Indica II | 465 | 6.70% | 1.10% | 16.13% | 76.13% | NA |
| Indica III | 913 | 7.70% | 0.80% | 18.51% | 73.06% | NA |
| Indica Intermediate | 786 | 16.30% | 0.80% | 17.18% | 65.78% | NA |
| Temperate Japonica | 767 | 91.30% | 0.40% | 0.26% | 8.08% | NA |
| Tropical Japonica | 504 | 79.60% | 0.00% | 0.60% | 19.84% | NA |
| Japonica Intermediate | 241 | 82.20% | 0.00% | 2.49% | 15.35% | NA |
| VI/Aromatic | 96 | 94.80% | 1.00% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 58.90% | 0.00% | 5.56% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116610872 | G -> A | LOC_Os11g28710.1 | upstream_gene_variant ; 435.0bp to feature; MODIFIER | silent_mutation | Average:9.728; most accessible tissue: Zhenshan97 root, score: 16.934 | N | N | N | N |
| vg1116610872 | G -> A | LOC_Os11g28720.1 | upstream_gene_variant ; 1186.0bp to feature; MODIFIER | silent_mutation | Average:9.728; most accessible tissue: Zhenshan97 root, score: 16.934 | N | N | N | N |
| vg1116610872 | G -> A | LOC_Os11g28730.1 | downstream_gene_variant ; 4461.0bp to feature; MODIFIER | silent_mutation | Average:9.728; most accessible tissue: Zhenshan97 root, score: 16.934 | N | N | N | N |
| vg1116610872 | G -> A | LOC_Os11g28710-LOC_Os11g28720 | intergenic_region ; MODIFIER | silent_mutation | Average:9.728; most accessible tissue: Zhenshan97 root, score: 16.934 | N | N | N | N |
| vg1116610872 | G -> DEL | N | N | silent_mutation | Average:9.728; most accessible tissue: Zhenshan97 root, score: 16.934 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116610872 | NA | 1.15E-07 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116610872 | 9.23E-07 | 7.46E-07 | mr1071_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116610872 | 5.20E-07 | 2.40E-06 | mr1080_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116610872 | 6.00E-07 | 2.25E-07 | mr1203_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116610872 | 4.00E-06 | 1.32E-06 | mr1402_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116610872 | NA | 4.12E-07 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116610872 | 9.68E-08 | 2.39E-08 | mr1619_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116610872 | NA | 1.99E-06 | mr1795_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116610872 | NA | 6.96E-06 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116610872 | NA | 9.80E-07 | mr1962_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |