\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116610872:

Variant ID: vg1116610872 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16610872
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAACATATGCCCCTAGAGGCACCCGGACCCCCCTTATATATGGGAAGGAGTCCGTGTTACAAAAGATAATCTATATCCCTAACGGAATATACAAATACAG[G/A]
TAAAATACAGTCGTAACCGACTAAGTCTCAAGGTGTTTCCTTGATGTACAAGTTAAGAAACAAACCCGAGATACAAATAAGATATTCTATATATATTCGG

Reverse complement sequence

CCGAATATATATAGAATATCTTATTTGTATCTCGGGTTTGTTTCTTAACTTGTACATCAAGGAAACACCTTGAGACTTAGTCGGTTACGACTGTATTTTA[C/T]
CTGTATTTGTATATTCCGTTAGGGATATAGATTATCTTTTGTAACACGGACTCCTTCCCATATATAAGGGGGGTCCGGGTGCCTCTAGGGGCATATGTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.00% 0.50% 11.07% 49.37% NA
All Indica  2759 11.30% 0.80% 16.17% 71.73% NA
All Japonica  1512 85.90% 0.20% 0.73% 13.16% NA
Aus  269 33.10% 0.00% 22.30% 44.61% NA
Indica I  595 14.10% 0.50% 11.26% 74.12% NA
Indica II  465 6.70% 1.10% 16.13% 76.13% NA
Indica III  913 7.70% 0.80% 18.51% 73.06% NA
Indica Intermediate  786 16.30% 0.80% 17.18% 65.78% NA
Temperate Japonica  767 91.30% 0.40% 0.26% 8.08% NA
Tropical Japonica  504 79.60% 0.00% 0.60% 19.84% NA
Japonica Intermediate  241 82.20% 0.00% 2.49% 15.35% NA
VI/Aromatic  96 94.80% 1.00% 1.04% 3.12% NA
Intermediate  90 58.90% 0.00% 5.56% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1116610872 G -> A LOC_Os11g28710.1 upstream_gene_variant ; 435.0bp to feature; MODIFIER silent_mutation Average:9.728; most accessible tissue: Zhenshan97 root, score: 16.934 N N N N
vg1116610872 G -> A LOC_Os11g28720.1 upstream_gene_variant ; 1186.0bp to feature; MODIFIER silent_mutation Average:9.728; most accessible tissue: Zhenshan97 root, score: 16.934 N N N N
vg1116610872 G -> A LOC_Os11g28730.1 downstream_gene_variant ; 4461.0bp to feature; MODIFIER silent_mutation Average:9.728; most accessible tissue: Zhenshan97 root, score: 16.934 N N N N
vg1116610872 G -> A LOC_Os11g28710-LOC_Os11g28720 intergenic_region ; MODIFIER silent_mutation Average:9.728; most accessible tissue: Zhenshan97 root, score: 16.934 N N N N
vg1116610872 G -> DEL N N silent_mutation Average:9.728; most accessible tissue: Zhenshan97 root, score: 16.934 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1116610872 NA 1.15E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116610872 9.23E-07 7.46E-07 mr1071_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116610872 5.20E-07 2.40E-06 mr1080_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116610872 6.00E-07 2.25E-07 mr1203_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116610872 4.00E-06 1.32E-06 mr1402_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116610872 NA 4.12E-07 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116610872 9.68E-08 2.39E-08 mr1619_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116610872 NA 1.99E-06 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116610872 NA 6.96E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116610872 NA 9.80E-07 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251