Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1116610872:

Variant ID: vg1116610872 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 16610872
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAACATATGCCCCTAGAGGCACCCGGACCCCCCTTATATATGGGAAGGAGTCCGTGTTACAAAAGATAATCTATATCCCTAACGGAATATACAAATACAG[G/A]
TAAAATACAGTCGTAACCGACTAAGTCTCAAGGTGTTTCCTTGATGTACAAGTTAAGAAACAAACCCGAGATACAAATAAGATATTCTATATATATTCGG

Reverse complement sequence

CCGAATATATATAGAATATCTTATTTGTATCTCGGGTTTGTTTCTTAACTTGTACATCAAGGAAACACCTTGAGACTTAGTCGGTTACGACTGTATTTTA[C/T]
CTGTATTTGTATATTCCGTTAGGGATATAGATTATCTTTTGTAACACGGACTCCTTCCCATATATAAGGGGGGTCCGGGTGCCTCTAGGGGCATATGTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.00%	0.50%	11.07%	49.37%	NA
All Indica	2759	11.30%	0.80%	16.17%	71.73%	NA
All Japonica	1512	85.90%	0.20%	0.73%	13.16%	NA
Aus	269	33.10%	0.00%	22.30%	44.61%	NA
Indica I	595	14.10%	0.50%	11.26%	74.12%	NA
Indica II	465	6.70%	1.10%	16.13%	76.13%	NA
Indica III	913	7.70%	0.80%	18.51%	73.06%	NA
Indica Intermediate	786	16.30%	0.80%	17.18%	65.78%	NA
Temperate Japonica	767	91.30%	0.40%	0.26%	8.08%	NA
Tropical Japonica	504	79.60%	0.00%	0.60%	19.84%	NA
Japonica Intermediate	241	82.20%	0.00%	2.49%	15.35%	NA
VI/Aromatic	96	94.80%	1.00%	1.04%	3.12%	NA
Intermediate	90	58.90%	0.00%	5.56%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1116610872	G -> A	LOC_Os11g28710.1	upstream_gene_variant ; 435.0bp to feature; MODIFIER	silent_mutation	Average:9.728; most accessible tissue: Zhenshan97 root, score: 16.934	N	N	N	N
vg1116610872	G -> A	LOC_Os11g28720.1	upstream_gene_variant ; 1186.0bp to feature; MODIFIER	silent_mutation	Average:9.728; most accessible tissue: Zhenshan97 root, score: 16.934	N	N	N	N
vg1116610872	G -> A	LOC_Os11g28730.1	downstream_gene_variant ; 4461.0bp to feature; MODIFIER	silent_mutation	Average:9.728; most accessible tissue: Zhenshan97 root, score: 16.934	N	N	N	N
vg1116610872	G -> A	LOC_Os11g28710-LOC_Os11g28720	intergenic_region ; MODIFIER	silent_mutation	Average:9.728; most accessible tissue: Zhenshan97 root, score: 16.934	N	N	N	N
vg1116610872	G -> DEL	N	N	silent_mutation	Average:9.728; most accessible tissue: Zhenshan97 root, score: 16.934	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1116610872	NA	1.15E-07	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116610872	9.23E-07	7.46E-07	mr1071_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116610872	5.20E-07	2.40E-06	mr1080_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116610872	6.00E-07	2.25E-07	mr1203_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116610872	4.00E-06	1.32E-06	mr1402_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116610872	NA	4.12E-07	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116610872	9.68E-08	2.39E-08	mr1619_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116610872	NA	1.99E-06	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116610872	NA	6.96E-06	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116610872	NA	9.80E-07	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251