Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116564255:

Variant ID: vg1116564255 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 16564255
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAACTGAGGGAAATTTGATGCTTCAGTTGGACTCATGTACTCAAGTACCCACTCTGCTTCTGCTGGTAATTAATACTCCCTCCGTTTCAAAATATTGACA[T/C]
CGTTGACTTTTTTTTCACATGTTTGACCATTCGTCTTATTAAAAAAATTTATGAGATATATAAAACTATATGTGTACATGAAAGTATATTTAACAATGAA

Reverse complement sequence

TTCATTGTTAAATATACTTTCATGTACACATATAGTTTTATATATCTCATAAATTTTTTTAATAAGACGAATGGTCAAACATGTGAAAAAAAAGTCAACG[A/G]
TGTCAATATTTTGAAACGGAGGGAGTATTAATTACCAGCAGAAGCAGAGTGGGTACTTGAGTACATGAGTCCAACTGAAGCATCAAATTTCCCTCAGTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.40%	23.70%	0.15%	13.75%	NA
All Indica	2759	76.10%	2.90%	0.07%	20.99%	NA
All Japonica	1512	48.50%	47.00%	0.13%	4.30%	NA
Aus	269	17.10%	82.90%	0.00%	0.00%	NA
Indica I	595	89.90%	1.00%	0.00%	9.08%	NA
Indica II	465	91.00%	1.30%	0.00%	7.74%	NA
Indica III	913	59.00%	3.10%	0.11%	37.79%	NA
Indica Intermediate	786	76.60%	5.00%	0.13%	18.32%	NA
Temperate Japonica	767	16.90%	81.60%	0.00%	1.43%	NA
Tropical Japonica	504	83.10%	7.10%	0.40%	9.33%	NA
Japonica Intermediate	241	76.80%	20.30%	0.00%	2.90%	NA
VI/Aromatic	96	8.30%	90.60%	1.04%	0.00%	NA
Intermediate	90	68.90%	22.20%	2.22%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1116564255	T -> DEL	N	N	silent_mutation	Average:28.791; most accessible tissue: Callus, score: 49.153	N	N	N	N
vg1116564255	T -> C	LOC_Os11g28640-LOC_Os11g28650	intergenic_region ; MODIFIER	silent_mutation	Average:28.791; most accessible tissue: Callus, score: 49.153	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1116564255	NA	3.41E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	1.07E-10	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	1.26E-11	mr1157	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	2.12E-06	mr1157	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	1.36E-06	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	6.34E-14	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	2.36E-12	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	9.09E-10	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	1.64E-09	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	1.51E-13	mr1446	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	7.66E-06	mr1446	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	4.90E-08	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	1.83E-11	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	1.41E-17	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	1.24E-06	mr1614	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	5.42E-08	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	5.78E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	5.60E-08	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	1.61E-07	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	2.65E-19	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	1.79E-09	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	9.00E-09	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	4.81E-09	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	8.79E-06	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	6.23E-10	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	3.92E-08	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	4.78E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	1.80E-10	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255	NA	4.47E-07	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251