\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116564255:

Variant ID: vg1116564255 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16564255
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACTGAGGGAAATTTGATGCTTCAGTTGGACTCATGTACTCAAGTACCCACTCTGCTTCTGCTGGTAATTAATACTCCCTCCGTTTCAAAATATTGACA[T/C]
CGTTGACTTTTTTTTCACATGTTTGACCATTCGTCTTATTAAAAAAATTTATGAGATATATAAAACTATATGTGTACATGAAAGTATATTTAACAATGAA

Reverse complement sequence

TTCATTGTTAAATATACTTTCATGTACACATATAGTTTTATATATCTCATAAATTTTTTTAATAAGACGAATGGTCAAACATGTGAAAAAAAAGTCAACG[A/G]
TGTCAATATTTTGAAACGGAGGGAGTATTAATTACCAGCAGAAGCAGAGTGGGTACTTGAGTACATGAGTCCAACTGAAGCATCAAATTTCCCTCAGTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 23.70% 0.15% 13.75% NA
All Indica  2759 76.10% 2.90% 0.07% 20.99% NA
All Japonica  1512 48.50% 47.00% 0.13% 4.30% NA
Aus  269 17.10% 82.90% 0.00% 0.00% NA
Indica I  595 89.90% 1.00% 0.00% 9.08% NA
Indica II  465 91.00% 1.30% 0.00% 7.74% NA
Indica III  913 59.00% 3.10% 0.11% 37.79% NA
Indica Intermediate  786 76.60% 5.00% 0.13% 18.32% NA
Temperate Japonica  767 16.90% 81.60% 0.00% 1.43% NA
Tropical Japonica  504 83.10% 7.10% 0.40% 9.33% NA
Japonica Intermediate  241 76.80% 20.30% 0.00% 2.90% NA
VI/Aromatic  96 8.30% 90.60% 1.04% 0.00% NA
Intermediate  90 68.90% 22.20% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1116564255 T -> DEL N N silent_mutation Average:28.791; most accessible tissue: Callus, score: 49.153 N N N N
vg1116564255 T -> C LOC_Os11g28640-LOC_Os11g28650 intergenic_region ; MODIFIER silent_mutation Average:28.791; most accessible tissue: Callus, score: 49.153 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1116564255 NA 3.41E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 1.07E-10 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 1.26E-11 mr1157 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 2.12E-06 mr1157 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 1.36E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 6.34E-14 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 2.36E-12 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 9.09E-10 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 1.64E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 1.51E-13 mr1446 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 7.66E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 4.90E-08 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 1.83E-11 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 1.41E-17 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 1.24E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 5.42E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 5.78E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 5.60E-08 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 1.61E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 2.65E-19 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 1.79E-09 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 9.00E-09 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 4.81E-09 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 8.79E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 6.23E-10 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 3.92E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 4.78E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 1.80E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116564255 NA 4.47E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251