Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116563054:

Variant ID: vg1116563054 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 16563054
Reference Allele: T	Alternative Allele: C,TC
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACTGTTTTTATTTTTCTCGTGCATTTTCTATTTTTAAATAGTTAGATTAGATTAGAGATAGAGAAGAGATATATAGTGATTAGAAATCGGAATTTTTTT[T/C,TC]
GCCCTTTCCATTTTTTTCTCGCATGCATTTTTTATTTTGTACGAACCAGCATTTTTTTTACGAACCATTTTTTCGCCACTTTCTTAGGGAATCGAACGAA

Reverse complement sequence

TTCGTTCGATTCCCTAAGAAAGTGGCGAAAAAATGGTTCGTAAAAAAAATGCTGGTTCGTACAAAATAAAAAATGCATGCGAGAAAAAAATGGAAAGGGC[A/G,GA]
AAAAAAATTCCGATTTCTAATCACTATATATCTCTTCTCTATCTCTAATCTAATCTAACTATTTAAAAATAGAAAATGCACGAGAAAAATAAAAACAGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.80%	18.70%	0.25%	13.80%	TC: 5.50%
All Indica	2759	75.00%	1.70%	0.25%	21.06%	TC: 1.92%
All Japonica	1512	48.50%	46.80%	0.26%	4.30%	TC: 0.07%
Aus	269	16.40%	9.70%	0.00%	0.00%	TC: 73.98%
Indica I	595	88.90%	1.50%	0.34%	9.08%	TC: 0.17%
Indica II	465	91.20%	0.60%	0.00%	7.74%	TC: 0.43%
Indica III	913	58.70%	0.30%	0.33%	37.90%	TC: 2.74%
Indica Intermediate	786	73.90%	4.20%	0.25%	18.45%	TC: 3.18%
Temperate Japonica	767	16.70%	81.40%	0.39%	1.43%	TC: 0.13%
Tropical Japonica	504	83.50%	6.90%	0.20%	9.33%	NA
Japonica Intermediate	241	76.80%	20.30%	0.00%	2.90%	NA
VI/Aromatic	96	8.30%	87.50%	1.04%	0.00%	TC: 3.12%
Intermediate	90	71.10%	17.80%	0.00%	6.67%	TC: 4.44%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1116563054	T -> TC	LOC_Os11g28640.1	upstream_gene_variant ; 4587.0bp to feature; MODIFIER	silent_mutation	Average:14.467; most accessible tissue: Callus, score: 23.146	N	N	N	N
vg1116563054	T -> TC	LOC_Os11g28640-LOC_Os11g28650	intergenic_region ; MODIFIER	silent_mutation	Average:14.467; most accessible tissue: Callus, score: 23.146	N	N	N	N
vg1116563054	T -> DEL	N	N	silent_mutation	Average:14.467; most accessible tissue: Callus, score: 23.146	N	N	N	N
vg1116563054	T -> C	LOC_Os11g28640.1	upstream_gene_variant ; 4586.0bp to feature; MODIFIER	silent_mutation	Average:14.467; most accessible tissue: Callus, score: 23.146	N	N	N	N
vg1116563054	T -> C	LOC_Os11g28640-LOC_Os11g28650	intergenic_region ; MODIFIER	silent_mutation	Average:14.467; most accessible tissue: Callus, score: 23.146	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1116563054	NA	5.15E-13	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116563054	NA	4.20E-10	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116563054	NA	4.15E-08	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116563054	NA	5.52E-11	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116563054	NA	1.51E-07	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116563054	NA	1.23E-08	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116563054	NA	9.44E-15	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116563054	NA	2.36E-06	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116563054	NA	4.91E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116563054	NA	3.17E-16	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116563054	2.60E-06	2.60E-06	mr1783	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116563054	NA	3.72E-08	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116563054	NA	5.01E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116563054	NA	1.63E-08	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116563054	NA	4.82E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116563054	NA	4.61E-10	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251