\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116508452:

Variant ID: vg1116508452 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16508452
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTTTTTATCAGATGAGCGTATACGTCCACTCTGCTATCTAACATATTCAAATTTTTGCAATCTACGCATGGACAACACATGTAATCGTTGTTCTTTTC[C/A]
TATCCTCCTCCACGGCATTAATAAAATTCAATACACCATCTCTATACTCCTTGGTATGACGTCGCACAGTTTTCCTATACATCCAACTTCGATCCATCGA

Reverse complement sequence

TCGATGGATCGAAGTTGGATGTATAGGAAAACTGTGCGACGTCATACCAAGGAGTATAGAGATGGTGTATTGAATTTTATTAATGCCGTGGAGGAGGATA[G/T]
GAAAAGAACAACGATTACATGTGTTGTCCATGCGTAGATTGCAAAAATTTGAATATGTTAGATAGCAGAGTGGACGTATACGCTCATCTGATAAAAAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.90% 15.00% 0.17% 0.00% NA
All Indica  2759 78.40% 21.30% 0.29% 0.00% NA
All Japonica  1512 95.50% 4.50% 0.00% 0.00% NA
Aus  269 87.40% 12.60% 0.00% 0.00% NA
Indica I  595 89.20% 10.30% 0.50% 0.00% NA
Indica II  465 92.50% 7.50% 0.00% 0.00% NA
Indica III  913 62.00% 37.60% 0.44% 0.00% NA
Indica Intermediate  786 80.90% 19.00% 0.13% 0.00% NA
Temperate Japonica  767 98.20% 1.80% 0.00% 0.00% NA
Tropical Japonica  504 90.70% 9.30% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1116508452 C -> A LOC_Os11g28600.1 upstream_gene_variant ; 517.0bp to feature; MODIFIER silent_mutation Average:38.751; most accessible tissue: Callus, score: 93.882 N N N N
vg1116508452 C -> A LOC_Os11g28610.1 upstream_gene_variant ; 1674.0bp to feature; MODIFIER silent_mutation Average:38.751; most accessible tissue: Callus, score: 93.882 N N N N
vg1116508452 C -> A LOC_Os11g28600-LOC_Os11g28610 intergenic_region ; MODIFIER silent_mutation Average:38.751; most accessible tissue: Callus, score: 93.882 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1116508452 NA 6.88E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116508452 3.01E-06 NA mr1213 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116508452 8.35E-06 6.56E-09 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116508452 NA 2.05E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116508452 1.76E-06 4.97E-07 mr1919 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116508452 NA 3.83E-06 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251