\
| Variant ID: vg1116508452 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16508452 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.01, others allele: 0.00, population size: 122. )
CTTTTTTTATCAGATGAGCGTATACGTCCACTCTGCTATCTAACATATTCAAATTTTTGCAATCTACGCATGGACAACACATGTAATCGTTGTTCTTTTC[C/A]
TATCCTCCTCCACGGCATTAATAAAATTCAATACACCATCTCTATACTCCTTGGTATGACGTCGCACAGTTTTCCTATACATCCAACTTCGATCCATCGA
TCGATGGATCGAAGTTGGATGTATAGGAAAACTGTGCGACGTCATACCAAGGAGTATAGAGATGGTGTATTGAATTTTATTAATGCCGTGGAGGAGGATA[G/T]
GAAAAGAACAACGATTACATGTGTTGTCCATGCGTAGATTGCAAAAATTTGAATATGTTAGATAGCAGAGTGGACGTATACGCTCATCTGATAAAAAAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.90% | 15.00% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 78.40% | 21.30% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 87.40% | 12.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.20% | 10.30% | 0.50% | 0.00% | NA |
| Indica II | 465 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 62.00% | 37.60% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 80.90% | 19.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.70% | 9.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116508452 | C -> A | LOC_Os11g28600.1 | upstream_gene_variant ; 517.0bp to feature; MODIFIER | silent_mutation | Average:38.751; most accessible tissue: Callus, score: 93.882 | N | N | N | N |
| vg1116508452 | C -> A | LOC_Os11g28610.1 | upstream_gene_variant ; 1674.0bp to feature; MODIFIER | silent_mutation | Average:38.751; most accessible tissue: Callus, score: 93.882 | N | N | N | N |
| vg1116508452 | C -> A | LOC_Os11g28600-LOC_Os11g28610 | intergenic_region ; MODIFIER | silent_mutation | Average:38.751; most accessible tissue: Callus, score: 93.882 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116508452 | NA | 6.88E-06 | mr1031 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116508452 | 3.01E-06 | NA | mr1213 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116508452 | 8.35E-06 | 6.56E-09 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116508452 | NA | 2.05E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116508452 | 1.76E-06 | 4.97E-07 | mr1919 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116508452 | NA | 3.83E-06 | mr1919 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |