\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116506738:

Variant ID: vg1116506738 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16506738
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTCATGGTCATCTTCATGTGCACCACTTCCTGATTCGTGCTCATGATCTTCACATTCTTCATTTTGTGCACCATTTTAGGTTTTCGTTGGTGGAATTT[A/G]
GAGCCGCCACAAAGCAATGGCCAGTGAAGATCTGATCTTCACTGGCGGTCATCTTAAGCCAGCCGCTAGCAAAGATCCATTTTTGCTGGTGGTTAGATTA

Reverse complement sequence

TAATCTAACCACCAGCAAAAATGGATCTTTGCTAGCGGCTGGCTTAAGATGACCGCCAGTGAAGATCAGATCTTCACTGGCCATTGCTTTGTGGCGGCTC[T/C]
AAATTCCACCAACGAAAACCTAAAATGGTGCACAAAATGAAGAATGTGAAGATCATGAGCACGAATCAGGAAGTGGTGCACATGAAGATGACCATGACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.40% 17.40% 0.19% 0.00% NA
All Indica  2759 99.20% 0.70% 0.11% 0.00% NA
All Japonica  1512 54.40% 45.20% 0.33% 0.00% NA
Aus  269 92.60% 7.40% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.30% 0.38% 0.00% NA
Temperate Japonica  767 21.40% 78.10% 0.52% 0.00% NA
Tropical Japonica  504 93.10% 6.90% 0.00% 0.00% NA
Japonica Intermediate  241 78.80% 20.70% 0.41% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1116506738 A -> G LOC_Os11g28610.1 upstream_gene_variant ; 3388.0bp to feature; MODIFIER silent_mutation Average:43.567; most accessible tissue: Callus, score: 92.533 N N N N
vg1116506738 A -> G LOC_Os11g28600.1 downstream_gene_variant ; 215.0bp to feature; MODIFIER silent_mutation Average:43.567; most accessible tissue: Callus, score: 92.533 N N N N
vg1116506738 A -> G LOC_Os11g28590-LOC_Os11g28600 intergenic_region ; MODIFIER silent_mutation Average:43.567; most accessible tissue: Callus, score: 92.533 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1116506738 4.24E-09 2.40E-30 mr1137 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738 4.14E-06 2.46E-14 mr1137 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738 NA 9.96E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738 NA 2.39E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738 NA 1.63E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738 NA 2.46E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738 NA 4.48E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738 NA 3.53E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738 NA 8.85E-08 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738 NA 1.33E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738 4.00E-06 NA mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738 NA 3.86E-11 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738 NA 3.22E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738 3.80E-07 NA mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738 NA 2.01E-10 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738 NA 8.11E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738 NA 4.95E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251