Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1116506738:

Variant ID: vg1116506738 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 16506738
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGTCATGGTCATCTTCATGTGCACCACTTCCTGATTCGTGCTCATGATCTTCACATTCTTCATTTTGTGCACCATTTTAGGTTTTCGTTGGTGGAATTT[A/G]
GAGCCGCCACAAAGCAATGGCCAGTGAAGATCTGATCTTCACTGGCGGTCATCTTAAGCCAGCCGCTAGCAAAGATCCATTTTTGCTGGTGGTTAGATTA

Reverse complement sequence

TAATCTAACCACCAGCAAAAATGGATCTTTGCTAGCGGCTGGCTTAAGATGACCGCCAGTGAAGATCAGATCTTCACTGGCCATTGCTTTGTGGCGGCTC[T/C]
AAATTCCACCAACGAAAACCTAAAATGGTGCACAAAATGAAGAATGTGAAGATCATGAGCACGAATCAGGAAGTGGTGCACATGAAGATGACCATGACAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.40%	17.40%	0.19%	0.00%	NA
All Indica	2759	99.20%	0.70%	0.11%	0.00%	NA
All Japonica	1512	54.40%	45.20%	0.33%	0.00%	NA
Aus	269	92.60%	7.40%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.30%	0.38%	0.00%	NA
Temperate Japonica	767	21.40%	78.10%	0.52%	0.00%	NA
Tropical Japonica	504	93.10%	6.90%	0.00%	0.00%	NA
Japonica Intermediate	241	78.80%	20.70%	0.41%	0.00%	NA
VI/Aromatic	96	13.50%	86.50%	0.00%	0.00%	NA
Intermediate	90	82.20%	16.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1116506738	A -> G	LOC_Os11g28610.1	upstream_gene_variant ; 3388.0bp to feature; MODIFIER	silent_mutation	Average:43.567; most accessible tissue: Callus, score: 92.533	N	N	N	N
vg1116506738	A -> G	LOC_Os11g28600.1	downstream_gene_variant ; 215.0bp to feature; MODIFIER	silent_mutation	Average:43.567; most accessible tissue: Callus, score: 92.533	N	N	N	N
vg1116506738	A -> G	LOC_Os11g28590-LOC_Os11g28600	intergenic_region ; MODIFIER	silent_mutation	Average:43.567; most accessible tissue: Callus, score: 92.533	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1116506738	4.24E-09	2.40E-30	mr1137	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738	4.14E-06	2.46E-14	mr1137	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738	NA	9.96E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738	NA	2.39E-21	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738	NA	1.63E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738	NA	2.46E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738	NA	4.48E-09	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738	NA	3.53E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738	NA	8.85E-08	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738	NA	1.33E-06	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738	4.00E-06	NA	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738	NA	3.86E-11	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738	NA	3.22E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738	3.80E-07	NA	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738	NA	2.01E-10	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738	NA	8.11E-07	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116506738	NA	4.95E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251