\
| Variant ID: vg1116506738 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16506738 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGTCATGGTCATCTTCATGTGCACCACTTCCTGATTCGTGCTCATGATCTTCACATTCTTCATTTTGTGCACCATTTTAGGTTTTCGTTGGTGGAATTT[A/G]
GAGCCGCCACAAAGCAATGGCCAGTGAAGATCTGATCTTCACTGGCGGTCATCTTAAGCCAGCCGCTAGCAAAGATCCATTTTTGCTGGTGGTTAGATTA
TAATCTAACCACCAGCAAAAATGGATCTTTGCTAGCGGCTGGCTTAAGATGACCGCCAGTGAAGATCAGATCTTCACTGGCCATTGCTTTGTGGCGGCTC[T/C]
AAATTCCACCAACGAAAACCTAAAATGGTGCACAAAATGAAGAATGTGAAGATCATGAGCACGAATCAGGAAGTGGTGCACATGAAGATGACCATGACAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.40% | 17.40% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.70% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 54.40% | 45.20% | 0.33% | 0.00% | NA |
| Aus | 269 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.30% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 21.40% | 78.10% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.80% | 20.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116506738 | A -> G | LOC_Os11g28610.1 | upstream_gene_variant ; 3388.0bp to feature; MODIFIER | silent_mutation | Average:43.567; most accessible tissue: Callus, score: 92.533 | N | N | N | N |
| vg1116506738 | A -> G | LOC_Os11g28600.1 | downstream_gene_variant ; 215.0bp to feature; MODIFIER | silent_mutation | Average:43.567; most accessible tissue: Callus, score: 92.533 | N | N | N | N |
| vg1116506738 | A -> G | LOC_Os11g28590-LOC_Os11g28600 | intergenic_region ; MODIFIER | silent_mutation | Average:43.567; most accessible tissue: Callus, score: 92.533 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116506738 | 4.24E-09 | 2.40E-30 | mr1137 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116506738 | 4.14E-06 | 2.46E-14 | mr1137 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116506738 | NA | 9.96E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116506738 | NA | 2.39E-21 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116506738 | NA | 1.63E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116506738 | NA | 2.46E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116506738 | NA | 4.48E-09 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116506738 | NA | 3.53E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116506738 | NA | 8.85E-08 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116506738 | NA | 1.33E-06 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116506738 | 4.00E-06 | NA | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116506738 | NA | 3.86E-11 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116506738 | NA | 3.22E-07 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116506738 | 3.80E-07 | NA | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116506738 | NA | 2.01E-10 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116506738 | NA | 8.11E-07 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116506738 | NA | 4.95E-07 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |