| Variant ID: vg1116495084 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16495084 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, G: 0.03, others allele: 0.00, population size: 109. )
AGAAGAGAAAAGCTACTAGAGCCATAGCCAAACTCTTCCGAAGGCTTCCGGACTCCTGATTTCTACTCTATTCCTATTCCACTAGCTAGATACTACTAAG[C/G]
TAAACTTGAGAGAAATGAGAGAGCTATTGCTTGAGGTGTGTGAGTGAAGTGAGAAGAGGAGCTCCTTAAATAGGCTGCCAATGACGGTTGTGGCAGTTGG
CCAACTGCCACAACCGTCATTGGCAGCCTATTTAAGGAGCTCCTCTTCTCACTTCACTCACACACCTCAAGCAATAGCTCTCTCATTTCTCTCAAGTTTA[G/C]
CTTAGTAGTATCTAGCTAGTGGAATAGGAATAGAGTAGAAATCAGGAGTCCGGAAGCCTTCGGAAGAGTTTGGCTATGGCTCTAGTAGCTTTTCTCTTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.80% | 34.30% | 1.97% | 26.94% | NA |
| All Indica | 2759 | 6.30% | 46.80% | 3.04% | 43.86% | NA |
| All Japonica | 1512 | 93.80% | 4.90% | 0.40% | 0.86% | NA |
| Aus | 269 | 8.20% | 82.20% | 0.37% | 9.29% | NA |
| Indica I | 595 | 6.20% | 23.90% | 3.87% | 66.05% | NA |
| Indica II | 465 | 6.00% | 54.40% | 3.44% | 36.13% | NA |
| Indica III | 913 | 4.60% | 57.10% | 3.07% | 35.27% | NA |
| Indica Intermediate | 786 | 8.40% | 47.80% | 2.16% | 41.60% | NA |
| Temperate Japonica | 767 | 96.50% | 2.20% | 0.13% | 1.17% | NA |
| Tropical Japonica | 504 | 88.90% | 9.70% | 0.60% | 0.79% | NA |
| Japonica Intermediate | 241 | 95.90% | 3.30% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 9.40% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 42.20% | 30.00% | 2.22% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116495084 | C -> DEL | N | N | silent_mutation | Average:13.453; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg1116495084 | C -> G | LOC_Os11g28590-LOC_Os11g28600 | intergenic_region ; MODIFIER | silent_mutation | Average:13.453; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116495084 | NA | 1.25E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116495084 | NA | 7.03E-08 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116495084 | NA | 7.03E-08 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116495084 | 3.90E-06 | NA | mr1504_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116495084 | 9.87E-07 | 5.48E-07 | mr1504_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116495084 | 8.04E-06 | 8.04E-06 | mr1693_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116495084 | NA | 1.19E-07 | mr1758_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |