| Variant ID: vg1116494226 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16494226 |
| Reference Allele: A | Alternative Allele: C,T |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTGGTATATTATGGTTACAGAGCTCATCCGCAAGCGCACGGATATACCATTGTAGCATTTCACCTAAGAGTATTCCAAGGGTATCGTATTTATTTTATCC[A/C,T]
GTGGGAAGATCATGTAGAGAGAGCTTGACTAATAATTTATATATTATTTGTGATAATCATATTCTAAGCAGGGGTTAAGATAATCCAAGAGTAGAGTGAC
GTCACTCTACTCTTGGATTATCTTAACCCCTGCTTAGAATATGATTATCACAAATAATATATAAATTATTAGTCAAGCTCTCTCTACATGATCTTCCCAC[T/G,A]
GGATAAAATAAATACGATACCCTTGGAATACTCTTAGGTGAAATGCTACAATGGTATATCCGTGCGCTTGCGGATGAGCTCTGTAACCATAATATACCAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.60% | 32.00% | 2.45% | 30.91% | T: 0.04% |
| All Indica | 2759 | 3.00% | 43.40% | 3.41% | 50.16% | T: 0.04% |
| All Japonica | 1512 | 93.70% | 4.90% | 0.20% | 1.19% | T: 0.07% |
| Aus | 269 | 7.40% | 77.70% | 4.46% | 10.41% | NA |
| Indica I | 595 | 3.40% | 22.20% | 2.02% | 72.44% | NA |
| Indica II | 465 | 2.40% | 43.90% | 8.82% | 44.95% | NA |
| Indica III | 913 | 0.90% | 56.30% | 0.88% | 41.95% | NA |
| Indica Intermediate | 786 | 5.50% | 44.30% | 4.20% | 45.93% | T: 0.13% |
| Temperate Japonica | 767 | 96.30% | 2.20% | 0.00% | 1.30% | T: 0.13% |
| Tropical Japonica | 504 | 88.50% | 9.70% | 0.60% | 1.19% | NA |
| Japonica Intermediate | 241 | 95.90% | 3.30% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 86.50% | 9.40% | 2.08% | 2.08% | NA |
| Intermediate | 90 | 36.70% | 25.60% | 5.56% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116494226 | A -> T | LOC_Os11g28590-LOC_Os11g28600 | intergenic_region ; MODIFIER | silent_mutation | Average:15.88; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1116494226 | A -> DEL | N | N | silent_mutation | Average:15.88; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1116494226 | A -> C | LOC_Os11g28590-LOC_Os11g28600 | intergenic_region ; MODIFIER | silent_mutation | Average:15.88; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116494226 | NA | 3.48E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116494226 | 4.21E-06 | 4.21E-06 | mr1468_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116494226 | NA | 1.19E-07 | mr1758_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |