\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116473187:

Variant ID: vg1116473187 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16473187
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCTATGGAATCAATCTGTATTTGAATCCAAACTCCATAGTCCACATTGCCAATTTCATCCATGTCTGTGAAGCTTTCTTGGGCATTAGGCCTCATTTT[G/T]
CCCTGTTCCGCCGAATCTTCTTCCTCAAGCCCCAACCAAACAAGAACAAACCATGCGTAGTTGGGGGGGCTGGATTTCAACTGAGAGGGACCTTGAGCCA

Reverse complement sequence

TGGCTCAAGGTCCCTCTCAGTTGAAATCCAGCCCCCCCAACTACGCATGGTTTGTTCTTGTTTGGTTGGGGCTTGAGGAAGAAGATTCGGCGGAACAGGG[C/A]
AAAATGAGGCCTAATGCCCAAGAAAGCTTCACAGACATGGATGAAATTGGCAATGTGGACTATGGAGTTTGGATTCAAATACAGATTGATTCCATAGAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 1.80% 0.97% 2.45% NA
All Indica  2759 92.70% 2.90% 1.49% 2.90% NA
All Japonica  1512 98.40% 0.00% 0.13% 1.46% NA
Aus  269 95.90% 0.00% 0.00% 4.09% NA
Indica I  595 97.50% 0.20% 2.35% 0.00% NA
Indica II  465 83.70% 9.90% 2.80% 3.66% NA
Indica III  913 93.90% 0.10% 0.33% 5.70% NA
Indica Intermediate  786 93.10% 4.10% 1.40% 1.40% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 95.60% 0.00% 0.20% 4.17% NA
Japonica Intermediate  241 99.20% 0.00% 0.41% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 4.40% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1116473187 G -> T LOC_Os11g28560.1 missense_variant ; p.Ala113Ser; MODERATE nonsynonymous_codon ; A113S Average:37.362; most accessible tissue: Minghui63 panicle, score: 56.842 benign 1.32 DELETERIOUS 0.01
vg1116473187 G -> DEL LOC_Os11g28560.1 N frameshift_variant Average:37.362; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1116473187 6.14E-06 6.14E-06 mr1054 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116473187 NA 5.62E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116473187 9.64E-07 9.63E-07 mr1287 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116473187 NA 4.02E-06 mr1297 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116473187 6.00E-06 1.40E-07 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116473187 NA 1.22E-07 mr1432 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116473187 NA 5.05E-06 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116473187 3.33E-07 3.33E-07 mr1465 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116473187 NA 7.09E-07 mr1537 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116473187 NA 7.55E-07 mr1550 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116473187 NA 3.66E-06 mr1665 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116473187 NA 2.04E-06 mr1713 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116473187 NA 9.88E-06 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116473187 NA 8.50E-06 mr1749 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116473187 NA 1.09E-09 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116473187 NA 5.65E-09 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116473187 NA 1.91E-06 mr1956 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116473187 NA 3.84E-07 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116473187 7.10E-06 7.10E-06 mr1972 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251