| Variant ID: vg1116395716 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16395716 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTTGCGATTTCAACCCGTGGAAGTAGGAAAAGGCTTATAAGTGCCAATTTTAGCACTTTCGGCACCTATAGTGCTGACACCTATTTTATGTTTTGTCGTA[G/A]
TGTACGTCTGTGTTTTTCTTAAGGACCCATTTGCACTCAATGGCTTTTACAGCATCAGGTTGATCAACCAAGTTCCATACTTCATTGTCATACATAGATT
AATCTATGTATGACAATGAAGTATGGAACTTGGTTGATCAACCTGATGCTGTAAAAGCCATTGAGTGCAAATGGGTCCTTAAGAAAAACACAGACGTACA[C/T]
TACGACAAAACATAAAATAGGTGTCAGCACTATAGGTGCCGAAAGTGCTAAAATTGGCACTTATAAGCCTTTTCCTACTTCCACGGGTTGAAATCGCAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.80% | 19.80% | 0.11% | 5.29% | NA |
| All Indica | 2759 | 91.80% | 5.70% | 0.14% | 2.43% | NA |
| All Japonica | 1512 | 43.80% | 47.00% | 0.00% | 9.13% | NA |
| Aus | 269 | 96.70% | 2.60% | 0.00% | 0.74% | NA |
| Indica I | 595 | 91.10% | 7.60% | 0.34% | 1.01% | NA |
| Indica II | 465 | 96.10% | 3.20% | 0.43% | 0.22% | NA |
| Indica III | 913 | 93.30% | 5.80% | 0.00% | 0.88% | NA |
| Indica Intermediate | 786 | 87.90% | 5.50% | 0.00% | 6.62% | NA |
| Temperate Japonica | 767 | 15.10% | 68.20% | 0.00% | 16.69% | NA |
| Tropical Japonica | 504 | 72.60% | 26.40% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 75.10% | 22.80% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 10.40% | 49.00% | 0.00% | 40.62% | NA |
| Intermediate | 90 | 77.80% | 16.70% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116395716 | G -> A | LOC_Os11g28480.1 | upstream_gene_variant ; 521.0bp to feature; MODIFIER | silent_mutation | Average:45.956; most accessible tissue: Callus, score: 98.144 | N | N | N | N |
| vg1116395716 | G -> A | LOC_Os11g28480-LOC_Os11g28490 | intergenic_region ; MODIFIER | silent_mutation | Average:45.956; most accessible tissue: Callus, score: 98.144 | N | N | N | N |
| vg1116395716 | G -> DEL | N | N | silent_mutation | Average:45.956; most accessible tissue: Callus, score: 98.144 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116395716 | NA | 8.92E-08 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116395716 | 2.07E-06 | NA | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116395716 | NA | 1.46E-08 | mr1530 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116395716 | NA | 9.36E-09 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116395716 | NA | 4.36E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116395716 | NA | 1.50E-06 | mr1982 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |