\
| Variant ID: vg1116393698 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16393698 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GATAGCACCCGCGCGCAACTAGAGTTTTGCTCCGGGAGGGGAGTGGCGGCTAGGGTTTCTCACGTGATCCAATGAATACGCTGGTCACACCCCGTCATAA[A/T]
TTTAGAGGATCCATGAATGGGTCTCCAAGACCCGTAGGACTCCTGTTTGGATCCCTATCCGAATTAAGCTTATATTTGATCTCCATCCAATCCCCCTACT
AGTAGGGGGATTGGATGGAGATCAAATATAAGCTTAATTCGGATAGGGATCCAAACAGGAGTCCTACGGGTCTTGGAGACCCATTCATGGATCCTCTAAA[T/A]
TTATGACGGGGTGTGACCAGCGTATTCATTGGATCACGTGAGAAACCCTAGCCGCCACTCCCCTCCCGGAGCAAAACTCTAGTTGCGCGCGGGTGCTATC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.30% | 13.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 58.80% | 41.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 86.40% | 13.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 31.20% | 68.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 28.60% | 71.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116393698 | A -> T | LOC_Os11g28480.1 | intron_variant ; MODIFIER | silent_mutation | Average:49.923; most accessible tissue: Callus, score: 87.759 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116393698 | NA | 1.95E-09 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116393698 | NA | 5.31E-13 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116393698 | NA | 3.18E-12 | mr1454 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116393698 | 4.75E-07 | NA | mr1530 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116393698 | NA | 2.78E-08 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116393698 | NA | 1.21E-12 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116393698 | NA | 1.01E-08 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116393698 | NA | 2.83E-13 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116393698 | NA | 4.07E-06 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116393698 | NA | 4.89E-09 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |