Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116298623:

Variant ID: vg1116298623 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16298623
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


TGCTAGCTGTCTCTGGTTTCTGTCTCTATGACCCCGTCTGAGTTTTTTCAAGGTAAAGATTACTGCTCCGTACGTCCGAATACATTAAAAAGTCATTAAT[G/A]
TATGATTTATTAAGTTTTAATTATTTTAAATCTGAAAATATATTTTATATGATATTTTTTTTAAAAAAACCTTGTATGTAGATAACGAAATGTATTATTT

Reverse complement sequence

AAATAATACATTTCGTTATCTACATACAAGGTTTTTTTAAAAAAAATATCATATAAAATATATTTTCAGATTTAAAATAATTAAAACTTAATAAATCATA[C/T]
ATTAATGACTTTTTAATGTATTCGGACGTACGGAGCAGTAATCTTTACCTTGAAAAAACTCAGACGGGGTCATAGAGACAGAAACCAGAGACAGCTAGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.60% 17.40% 0.02% 0.00% NA
All Indica  2759 76.50% 23.50% 0.00% 0.00% NA
All Japonica  1512 97.40% 2.60% 0.00% 0.00% NA
Aus  269 56.50% 43.10% 0.37% 0.00% NA
Indica I  595 77.50% 22.50% 0.00% 0.00% NA
Indica II  465 93.30% 6.70% 0.00% 0.00% NA
Indica III  913 61.30% 38.70% 0.00% 0.00% NA
Indica Intermediate  786 83.60% 16.40% 0.00% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 94.20% 5.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1116298623 G -> A LOC_Os11g28330.1 downstream_gene_variant ; 1721.0bp to feature; MODIFIER silent_mutation Average:59.692; most accessible tissue: Minghui63 panicle, score: 95.346 N N N N
vg1116298623 G -> A LOC_Os11g28330-LOC_Os11g28340 intergenic_region ; MODIFIER silent_mutation Average:59.692; most accessible tissue: Minghui63 panicle, score: 95.346 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1116298623 G A 0.03 0.03 0.02 -0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1116298623 3.44E-07 NA mr1758_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251