\
| Variant ID: vg1116285968 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16285968 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, C: 0.34, others allele: 0.00, population size: 107. )
CTAGCACCCAGGATAGTTTGATTAGGTTATGAACTACAGTTTCCTTTCACTAAAACTTGTTACCCTTCATCTTTTGCTTCTTTATACACTGCCCCACACC[T/C]
ACCAATTACCTTCAACAAAATTAACTATAAACAACAAAAAATAATATAGTTATAGTTATAAACTTGTTGCCCTTCATCTTTTGCTTCTTTATACACTGCC
GGCAGTGTATAAAGAAGCAAAAGATGAAGGGCAACAAGTTTATAACTATAACTATATTATTTTTTGTTGTTTATAGTTAATTTTGTTGAAGGTAATTGGT[A/G]
GGTGTGGGGCAGTGTATAAAGAAGCAAAAGATGAAGGGTAACAAGTTTTAGTGAAAGGAAACTGTAGTTCATAACCTAATCAAACTATCCTGGGTGCTAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.30% | 34.40% | 0.15% | 3.20% | NA |
| All Indica | 2759 | 93.20% | 1.80% | 0.18% | 4.82% | NA |
| All Japonica | 1512 | 3.40% | 95.80% | 0.07% | 0.73% | NA |
| Aus | 269 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.10% | 1.80% | 0.00% | 4.03% | NA |
| Indica II | 465 | 88.40% | 0.20% | 0.65% | 10.75% | NA |
| Indica III | 913 | 99.50% | 0.30% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 88.20% | 4.30% | 0.25% | 7.25% | NA |
| Temperate Japonica | 767 | 1.20% | 97.40% | 0.13% | 1.30% | NA |
| Tropical Japonica | 504 | 7.10% | 92.70% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 8.30% | 88.50% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 55.60% | 38.90% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116285968 | T -> DEL | N | N | silent_mutation | Average:55.637; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg1116285968 | T -> C | LOC_Os11g28310.1 | downstream_gene_variant ; 3243.0bp to feature; MODIFIER | silent_mutation | Average:55.637; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg1116285968 | T -> C | LOC_Os11g28310-LOC_Os11g28320 | intergenic_region ; MODIFIER | silent_mutation | Average:55.637; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116285968 | NA | 4.11E-81 | mr1134 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116285968 | NA | 5.09E-77 | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116285968 | NA | 2.59E-24 | mr1375 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116285968 | NA | 5.13E-14 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116285968 | NA | 3.90E-24 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116285968 | NA | 5.13E-14 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116285968 | NA | 1.59E-85 | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116285968 | NA | 3.97E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116285968 | NA | 9.07E-83 | mr1672 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116285968 | NA | 7.50E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116285968 | NA | 4.02E-21 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116285968 | NA | 3.21E-99 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116285968 | 1.36E-06 | 1.36E-06 | mr1050_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116285968 | 1.25E-07 | 3.43E-142 | mr1758_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116285968 | 2.13E-06 | 2.80E-09 | mr1758_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |