\
| Variant ID: vg1116232716 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16232716 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.62, C: 0.37, others allele: 0.00, population size: 103. )
AGTTTACAATGGCGAACTGCCTCCCCGTGCGAATCCTCAAAAGGCCGACGACGAGGCAGGGCCTTCGCGAAAGTGGATGCGTGGACAAGTGAAGCTTGCC[A/C]
CCAGGAAGCGAAGGGTTCCTGCTTCGTCTGACTCCGACACCGACGACGAGGATGATGCCGAAGAACGTGACGGCGAGGAGGAAGGAGAGGAAGAGGAGGA
TCCTCCTCTTCCTCTCCTTCCTCCTCGCCGTCACGTTCTTCGGCATCATCCTCGTCGTCGGTGTCGGAGTCAGACGAAGCAGGAACCCTTCGCTTCCTGG[T/G]
GGCAAGCTTCACTTGTCCACGCATCCACTTTCGCGAAGGCCCTGCCTCGTCGTCGGCCTTTTGAGGATTCGCACGGGGAGGCAGTTCGCCATTGTAAACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.90% | 34.60% | 1.35% | 0.11% | NA |
| All Indica | 2759 | 97.80% | 1.80% | 0.14% | 0.18% | NA |
| All Japonica | 1512 | 3.60% | 96.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 76.20% | 1.50% | 22.30% | 0.00% | NA |
| Indica I | 595 | 96.60% | 2.40% | 0.50% | 0.50% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.00% | 0.22% | NA |
| Indica III | 913 | 99.50% | 0.30% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.40% | 96.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 4.40% | 95.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 41.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116232716 | A -> DEL | LOC_Os11g28230.1 | N | frameshift_variant | Average:41.196; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| vg1116232716 | A -> C | LOC_Os11g28230.1 | missense_variant ; p.Thr485Pro; MODERATE | nonsynonymous_codon ; T485P | Average:41.196; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | possibly damaging |
-1.867 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116232716 | 9.47E-07 | NA | mr1164 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116232716 | NA | 1.78E-23 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116232716 | NA | 3.14E-17 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116232716 | NA | 1.42E-57 | mr1594 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116232716 | NA | 2.01E-08 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116232716 | NA | 1.32E-35 | mr1682 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116232716 | NA | 6.24E-19 | mr1754 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116232716 | 4.04E-09 | 1.01E-107 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116232716 | 9.57E-06 | 9.57E-06 | mr1758 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116232716 | 3.75E-08 | 4.91E-148 | mr1758_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116232716 | NA | 1.46E-08 | mr1758_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116232716 | NA | 2.97E-06 | mr1795_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |