Search for Variation information by Variation ID:
Detailed information for vg1116217816:
| Variant ID: vg1116217816 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16217816 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )
Flanking Sequence (100 bp) in Reference Genome:
AATGAGCAGATTTTGTTAGCCGATCCACTATTACCCAGATACTATCATTTCCTGGAGGTGTGGTAGGTAATCCTTGAACAAAGTCCATACTGATTTCTTC[C/T,A]
CATTTCCATAGTGGAATACTTAAGGGTTGTAACAGTCCTGCCGGCCTTTGATGTTCAACTTTTACGCATTGGCAGATATCACATTCTACAATGAATTTTG
Reverse complement sequence
CAAAATTCATTGTAGAATGTGATATCTGCCAATGCGTAAAAGTTGAACATCAAAGGCCGGCAGGACTGTTACAACCCTTAAGTATTCCACTATGGAAATG[G/A,T]
GAAGAAATCAGTATGGACTTTGTTCAAGGATTACCTACCACACCTCCAGGAAATGATAGTATCTGGGTAATAGTGGATCGGCTAACAAAATCTGCTCATT
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 9.60% | 0.55% | 0.00% | A: 0.04% |
| All Indica | 2759 | 83.30% | 15.80% | 0.94% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.30% | 0.00% | 0.00% | A: 0.13% |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.60% | 1.00% | 1.34% | 0.00% | NA |
| Indica II | 465 | 51.60% | 46.50% | 1.94% | 0.00% | NA |
| Indica III | 913 | 93.20% | 6.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 79.60% | 19.30% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.00% | 0.00% | A: 0.40% |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116217816 | C -> T | LOC_Os11g28210.1 | stop_gained ; p.Trp347*; HIGH | stop_gained | Average:39.706; most accessible tissue: Zhenshan97 young leaf, score: 67.334 | N | N | N | N |
| vg1116217816 | C -> A | LOC_Os11g28210.1 | missense_variant ; p.Trp347Cys; MODERATE | nonsynonymous_codon ; W347C | Average:39.706; most accessible tissue: Zhenshan97 young leaf, score: 67.334 | probably damaging  |
3.524 |
DELETERIOUS | 0.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116217816 | NA | 8.77E-08 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116217816 | NA | 3.52E-12 | mr1829 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116217816 | NA | 2.43E-07 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116217816 | NA | 2.16E-13 | mr1902 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116217816 | NA | 8.45E-06 | mr1050_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116217816 | NA | 3.93E-07 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116217816 | NA | 4.96E-12 | mr1829_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116217816 | NA | 1.32E-06 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116217816 | NA | 5.37E-12 | mr1902_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |