Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116207594:

Variant ID: vg1116207594 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 16207594
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

GCACTAGAGTAGTTATTAATTGCGTAGACGCGGTGTCTAGGTAATTAATTTCCAGTGGTTGCTGCGTATCCCACAGTACGTTTGAGGTGGGTGTAGAGGT[G/A]
GTGACAGCCCTCAAGAGAACTTAAGTCCTCCCTGTCCAGGTACGTAATAGAGCAACATCTGGAAACAGCGGGTTGCCAGTGCCTGAAGTATTGCGTTAGG

Reverse complement sequence

CCTAACGCAATACTTCAGGCACTGGCAACCCGCTGTTTCCAGATGTTGCTCTATTACGTACCTGGACAGGGAGGACTTAAGTTCTCTTGAGGGCTGTCAC[C/T]
ACCTCTACACCCACCTCAAACGTACTGTGGGATACGCAGCAACCACTGGAAATTAATTACCTAGACACCGCGTCTACGCAATTAATAACTACTCTAGTGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.10%	28.30%	0.11%	0.42%	NA
All Indica	2759	54.20%	44.90%	0.18%	0.72%	NA
All Japonica	1512	98.40%	1.60%	0.00%	0.00%	NA
Aus	269	81.40%	18.60%	0.00%	0.00%	NA
Indica I	595	38.20%	61.50%	0.00%	0.34%	NA
Indica II	465	58.90%	40.20%	0.22%	0.65%	NA
Indica III	913	58.10%	41.10%	0.22%	0.66%	NA
Indica Intermediate	786	59.00%	39.60%	0.25%	1.15%	NA
Temperate Japonica	767	98.30%	1.70%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1116207594	G -> A	LOC_Os11g28184.1	5_prime_UTR_variant ; 220.0bp to feature; MODIFIER	silent_mutation	Average:35.642; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg1116207594	G -> A	LOC_Os11g28184.3	5_prime_UTR_variant ; 220.0bp to feature; MODIFIER	silent_mutation	Average:35.642; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg1116207594	G -> A	LOC_Os11g28184.2	5_prime_UTR_variant ; 220.0bp to feature; MODIFIER	silent_mutation	Average:35.642; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg1116207594	G -> DEL	N	N	silent_mutation	Average:35.642; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1116207594	4.89E-06	1.59E-08	mr1825	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116207594	NA	5.04E-06	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116207594	NA	3.96E-06	mr1154_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251