\
| Variant ID: vg1116101996 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16101996 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 268. )
GTCCTTGTCTGGCGAAGTCCGAGTGTCCGAGCCAATGGCCTTCGCCATGGGACTTTCGCCCGTACGGTTCCCTTCTTGATCTTCGCCGCTTGCCTCCGGT[C/T]
TAAGCTTGTCGCTTAAGCCCTCAGTTTCGGCAGGTCCGGCTGAAGGCACTTCGTGGTATGCCTCCAACAATCACTACTAGTCAATTGTGGTCGACAAATG
CATTTGTCGACCACAATTGACTAGTAGTGATTGTTGGAGGCATACCACGAAGTGCCTTCAGCCGGACCTGCCGAAACTGAGGGCTTAAGCGACAAGCTTA[G/A]
ACCGGAGGCAAGCGGCGAAGATCAAGAAGGGAACCGTACGGGCGAAAGTCCCATGGCGAAGGCCATTGGCTCGGACACTCGGACTTCGCCAGACAAGGAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.80% | 1.40% | 0.83% | 0.00% | NA |
| All Indica | 2759 | 96.40% | 2.20% | 1.38% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.10% | 0.00% | 2.86% | 0.00% | NA |
| Indica II | 465 | 90.10% | 7.30% | 2.58% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.80% | 3.20% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116101996 | C -> T | LOC_Os11g28000.1 | upstream_gene_variant ; 4278.0bp to feature; MODIFIER | silent_mutation | Average:65.2; most accessible tissue: Zhenshan97 panicle, score: 84.824 | N | N | N | N |
| vg1116101996 | C -> T | LOC_Os11g28010.1 | upstream_gene_variant ; 53.0bp to feature; MODIFIER | silent_mutation | Average:65.2; most accessible tissue: Zhenshan97 panicle, score: 84.824 | N | N | N | N |
| vg1116101996 | C -> T | LOC_Os11g28010-LOC_Os11g28030 | intergenic_region ; MODIFIER | silent_mutation | Average:65.2; most accessible tissue: Zhenshan97 panicle, score: 84.824 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116101996 | NA | 1.13E-06 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116101996 | NA | 3.09E-06 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116101996 | NA | 8.32E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116101996 | NA | 2.83E-06 | mr1297 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116101996 | NA | 5.16E-06 | mr1372 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116101996 | NA | 5.33E-07 | mr1432 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116101996 | NA | 7.69E-06 | mr1433 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116101996 | 4.33E-06 | 1.90E-08 | mr1550 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116101996 | NA | 2.89E-07 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116101996 | NA | 1.67E-06 | mr1956 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116101996 | NA | 5.21E-07 | mr1310_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116101996 | NA | 7.57E-08 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116101996 | NA | 8.26E-09 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116101996 | NA | 1.15E-08 | mr1889_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116101996 | NA | 1.05E-06 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116101996 | NA | 1.40E-08 | mr1907_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116101996 | NA | 1.61E-06 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |