\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116101996:

Variant ID: vg1116101996 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16101996
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


GTCCTTGTCTGGCGAAGTCCGAGTGTCCGAGCCAATGGCCTTCGCCATGGGACTTTCGCCCGTACGGTTCCCTTCTTGATCTTCGCCGCTTGCCTCCGGT[C/T]
TAAGCTTGTCGCTTAAGCCCTCAGTTTCGGCAGGTCCGGCTGAAGGCACTTCGTGGTATGCCTCCAACAATCACTACTAGTCAATTGTGGTCGACAAATG

Reverse complement sequence

CATTTGTCGACCACAATTGACTAGTAGTGATTGTTGGAGGCATACCACGAAGTGCCTTCAGCCGGACCTGCCGAAACTGAGGGCTTAAGCGACAAGCTTA[G/A]
ACCGGAGGCAAGCGGCGAAGATCAAGAAGGGAACCGTACGGGCGAAAGTCCCATGGCGAAGGCCATTGGCTCGGACACTCGGACTTCGCCAGACAAGGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.80% 1.40% 0.83% 0.00% NA
All Indica  2759 96.40% 2.20% 1.38% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.10% 0.00% 2.86% 0.00% NA
Indica II  465 90.10% 7.30% 2.58% 0.00% NA
Indica III  913 99.70% 0.20% 0.11% 0.00% NA
Indica Intermediate  786 95.80% 3.20% 1.02% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1116101996 C -> T LOC_Os11g28000.1 upstream_gene_variant ; 4278.0bp to feature; MODIFIER silent_mutation Average:65.2; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N
vg1116101996 C -> T LOC_Os11g28010.1 upstream_gene_variant ; 53.0bp to feature; MODIFIER silent_mutation Average:65.2; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N
vg1116101996 C -> T LOC_Os11g28010-LOC_Os11g28030 intergenic_region ; MODIFIER silent_mutation Average:65.2; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1116101996 NA 1.13E-06 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116101996 NA 3.09E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116101996 NA 8.32E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116101996 NA 2.83E-06 mr1297 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116101996 NA 5.16E-06 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116101996 NA 5.33E-07 mr1432 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116101996 NA 7.69E-06 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116101996 4.33E-06 1.90E-08 mr1550 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116101996 NA 2.89E-07 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116101996 NA 1.67E-06 mr1956 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116101996 NA 5.21E-07 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116101996 NA 7.57E-08 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116101996 NA 8.26E-09 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116101996 NA 1.15E-08 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116101996 NA 1.05E-06 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116101996 NA 1.40E-08 mr1907_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116101996 NA 1.61E-06 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251