\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116054140:

Variant ID: vg1116054140 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16054140
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GCATCGACTCCCCTATCTGCTCCATCAACGTTGGCACCAGGCCAGCTGGTGAACCCTCGGTTGTTAATAAGAGAGCAGCCATAGCATAGTGGGCAGGTTG[T/C]
GAATCGGCTGACGCAAGATCAGGTTGCTACCACGTTTCTGCCACCTCAACCTACTGTTGATCCAATACAGCAGCAGACGATTCAACAGACACCCCCGATT

Reverse complement sequence

AATCGGGGGTGTCTGTTGAATCGTCTGCTGCTGTATTGGATCAACAGTAGGTTGAGGTGGCAGAAACGTGGTAGCAACCTGATCTTGCGTCAGCCGATTC[A/G]
CAACCTGCCCACTATGCTATGGCTGCTCTCTTATTAACAACCGAGGGTTCACCAGCTGGCCTGGTGCCAACGTTGATGGAGCAGATAGGGGAGTCGATGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 35.00% 0.38% 0.00% NA
All Indica  2759 97.00% 2.40% 0.62% 0.00% NA
All Japonica  1512 3.50% 96.50% 0.00% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 95.50% 4.20% 0.34% 0.00% NA
Indica II  465 98.10% 1.70% 0.22% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 94.90% 3.30% 1.78% 0.00% NA
Temperate Japonica  767 3.40% 96.60% 0.00% 0.00% NA
Tropical Japonica  504 4.20% 95.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 88.50% 1.04% 0.00% NA
Intermediate  90 58.90% 41.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1116054140 T -> C LOC_Os11g27880.1 downstream_gene_variant ; 3618.0bp to feature; MODIFIER silent_mutation Average:53.989; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N
vg1116054140 T -> C LOC_Os11g27900.1 downstream_gene_variant ; 2745.0bp to feature; MODIFIER silent_mutation Average:53.989; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N
vg1116054140 T -> C LOC_Os11g27890.1 intron_variant ; MODIFIER silent_mutation Average:53.989; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1116054140 NA 1.93E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116054140 NA 1.93E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116054140 NA 3.95E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116054140 6.26E-07 6.26E-07 mr1173_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116054140 1.90E-06 6.80E-06 mr1371_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116054140 NA 1.31E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116054140 NA 4.81E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251