\
| Variant ID: vg1116054140 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16054140 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 107. )
GCATCGACTCCCCTATCTGCTCCATCAACGTTGGCACCAGGCCAGCTGGTGAACCCTCGGTTGTTAATAAGAGAGCAGCCATAGCATAGTGGGCAGGTTG[T/C]
GAATCGGCTGACGCAAGATCAGGTTGCTACCACGTTTCTGCCACCTCAACCTACTGTTGATCCAATACAGCAGCAGACGATTCAACAGACACCCCCGATT
AATCGGGGGTGTCTGTTGAATCGTCTGCTGCTGTATTGGATCAACAGTAGGTTGAGGTGGCAGAAACGTGGTAGCAACCTGATCTTGCGTCAGCCGATTC[A/G]
CAACCTGCCCACTATGCTATGGCTGCTCTCTTATTAACAACCGAGGGTTCACCAGCTGGCCTGGTGCCAACGTTGATGGAGCAGATAGGGGAGTCGATGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.60% | 35.00% | 0.38% | 0.00% | NA |
| All Indica | 2759 | 97.00% | 2.40% | 0.62% | 0.00% | NA |
| All Japonica | 1512 | 3.50% | 96.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.50% | 4.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.90% | 3.30% | 1.78% | 0.00% | NA |
| Temperate Japonica | 767 | 3.40% | 96.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 88.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 41.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116054140 | T -> C | LOC_Os11g27880.1 | downstream_gene_variant ; 3618.0bp to feature; MODIFIER | silent_mutation | Average:53.989; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 | N | N | N | N |
| vg1116054140 | T -> C | LOC_Os11g27900.1 | downstream_gene_variant ; 2745.0bp to feature; MODIFIER | silent_mutation | Average:53.989; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 | N | N | N | N |
| vg1116054140 | T -> C | LOC_Os11g27890.1 | intron_variant ; MODIFIER | silent_mutation | Average:53.989; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116054140 | NA | 1.93E-14 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116054140 | NA | 1.93E-14 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116054140 | NA | 3.95E-07 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116054140 | 6.26E-07 | 6.26E-07 | mr1173_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116054140 | 1.90E-06 | 6.80E-06 | mr1371_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116054140 | NA | 1.31E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116054140 | NA | 4.81E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |