Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1116054140:

Variant ID: vg1116054140 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 16054140
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

GCATCGACTCCCCTATCTGCTCCATCAACGTTGGCACCAGGCCAGCTGGTGAACCCTCGGTTGTTAATAAGAGAGCAGCCATAGCATAGTGGGCAGGTTG[T/C]
GAATCGGCTGACGCAAGATCAGGTTGCTACCACGTTTCTGCCACCTCAACCTACTGTTGATCCAATACAGCAGCAGACGATTCAACAGACACCCCCGATT

Reverse complement sequence

AATCGGGGGTGTCTGTTGAATCGTCTGCTGCTGTATTGGATCAACAGTAGGTTGAGGTGGCAGAAACGTGGTAGCAACCTGATCTTGCGTCAGCCGATTC[A/G]
CAACCTGCCCACTATGCTATGGCTGCTCTCTTATTAACAACCGAGGGTTCACCAGCTGGCCTGGTGCCAACGTTGATGGAGCAGATAGGGGAGTCGATGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.60%	35.00%	0.38%	0.00%	NA
All Indica	2759	97.00%	2.40%	0.62%	0.00%	NA
All Japonica	1512	3.50%	96.50%	0.00%	0.00%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	95.50%	4.20%	0.34%	0.00%	NA
Indica II	465	98.10%	1.70%	0.22%	0.00%	NA
Indica III	913	99.10%	0.90%	0.00%	0.00%	NA
Indica Intermediate	786	94.90%	3.30%	1.78%	0.00%	NA
Temperate Japonica	767	3.40%	96.60%	0.00%	0.00%	NA
Tropical Japonica	504	4.20%	95.80%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	10.40%	88.50%	1.04%	0.00%	NA
Intermediate	90	58.90%	41.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1116054140	T -> C	LOC_Os11g27880.1	downstream_gene_variant ; 3618.0bp to feature; MODIFIER	silent_mutation	Average:53.989; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N
vg1116054140	T -> C	LOC_Os11g27900.1	downstream_gene_variant ; 2745.0bp to feature; MODIFIER	silent_mutation	Average:53.989; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N
vg1116054140	T -> C	LOC_Os11g27890.1	intron_variant ; MODIFIER	silent_mutation	Average:53.989; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1116054140	NA	1.93E-14	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116054140	NA	1.93E-14	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116054140	NA	3.95E-07	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116054140	6.26E-07	6.26E-07	mr1173_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116054140	1.90E-06	6.80E-06	mr1371_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116054140	NA	1.31E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116054140	NA	4.81E-06	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251