Search for Variation information by Variation ID:
Detailed information for vg1115982424:
| Variant ID: vg1115982424 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 15982424 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
TTTTGATCCTCATTGGGGTTGTGAGTTCAGGTTCTGCTGGAATGAGGGTATGAGGCTGCCATCTATCGAGGATTGTCCTGGGTGCAGCAATGTTGCAGGA[T/A]
GTTCAAGCCGATCGTATGATGGAGGCAATCGGCTGAAGCAAACAAGAGTTCCTGTTCATCAAAGGTTGGGTCCGGTGAACCAAGATTATAGCCGAGAGGA
Reverse complement sequence
TCCTCTCGGCTATAATCTTGGTTCACCGGACCCAACCTTTGATGAACAGGAACTCTTGTTTGCTTCAGCCGATTGCCTCCATCATACGATCGGCTTGAAC[A/T]
TCCTGCAACATTGCTGCACCCAGGACAATCCTCGATAGATGGCAGCCTCATACCCTCATTCCAGCAGAACCTGAACTCACAACCCCAATGAGGATCAAAA
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.40% | 16.90% | 5.65% | 40.03% | NA |
| All Indica | 2759 | 6.10% | 25.80% | 7.68% | 60.38% | NA |
| All Japonica | 1512 | 96.60% | 0.50% | 0.07% | 2.84% | NA |
| Aus | 269 | 4.80% | 23.00% | 16.36% | 55.76% | NA |
| Indica I | 595 | 13.60% | 10.10% | 4.54% | 71.76% | NA |
| Indica II | 465 | 3.70% | 35.10% | 5.59% | 55.70% | NA |
| Indica III | 913 | 1.60% | 30.40% | 9.75% | 58.16% | NA |
| Indica Intermediate | 786 | 7.10% | 26.80% | 8.91% | 57.12% | NA |
| Temperate Japonica | 767 | 96.70% | 0.30% | 0.13% | 2.87% | NA |
| Tropical Japonica | 504 | 96.00% | 0.60% | 0.00% | 3.37% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.80% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 90.60% | 2.10% | 5.21% | 2.08% | NA |
| Intermediate | 90 | 43.30% | 16.70% | 5.56% | 34.44% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1115982424 | T -> A | LOC_Os11g27760.1 | missense_variant ; p.Cys630Ser; MODERATE | nonsynonymous_codon ; C630S | Average:18.853; most accessible tissue: Zhenshan97 young leaf, score: 33.271 | probably damaging  |
-2.789 |
TOLERATED | 1.00 |
| vg1115982424 | T -> DEL | LOC_Os11g27760.1 | N | frameshift_variant | Average:18.853; most accessible tissue: Zhenshan97 young leaf, score: 33.271 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1115982424 | NA | 7.52E-07 | mr1818 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115982424 | 1.82E-07 | 7.19E-16 | mr1846 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115982424 | 3.69E-08 | 4.82E-13 | mr1846 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115982424 | NA | 5.54E-06 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115982424 | NA | 8.52E-15 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115982424 | NA | 2.29E-13 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |