\
| Variant ID: vg1115981616 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 15981616 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 96. )
ATGAGATGAAATTGTCTGATTTAACAGCAATCAAGAAAAGACACGATGAACCTGTACTTGAGTATATTCAGAGGTTCAGAGAGATGTGGAATAAGTGCTA[C/T]
AGCTTGAGTTTGACTGATGCCCAGTTAGCCGATTTGGCTTTTCAGGGTATGATTGCTCCGATCAGGGAGAAATTCTCAGCTGAAGACTTTGACAGCTTGT
ACAAGCTGTCAAAGTCTTCAGCTGAGAATTTCTCCCTGATCGGAGCAATCATACCCTGAAAAGCCAAATCGGCTAACTGGGCATCAGTCAAACTCAAGCT[G/A]
TAGCACTTATTCCACATCTCTCTGAACCTCTGAATATACTCAAGTACAGGTTCATCGTGTCTTTTCTTGATTGCTGTTAAATCAGACAATTTCATCTCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.70% | 23.10% | 27.04% | 0.15% | NA |
| All Indica | 2759 | 23.40% | 35.80% | 40.59% | 0.25% | NA |
| All Japonica | 1512 | 97.80% | 0.50% | 1.72% | 0.00% | NA |
| Aus | 269 | 33.10% | 29.00% | 37.92% | 0.00% | NA |
| Indica I | 595 | 19.50% | 22.40% | 57.65% | 0.50% | NA |
| Indica II | 465 | 18.70% | 38.10% | 43.23% | 0.00% | NA |
| Indica III | 913 | 26.90% | 45.30% | 27.60% | 0.11% | NA |
| Indica Intermediate | 786 | 24.90% | 33.50% | 41.22% | 0.38% | NA |
| Temperate Japonica | 767 | 97.50% | 0.30% | 2.22% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 0.80% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 1.00% | 6.25% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 17.80% | 26.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1115981616 | C -> T | LOC_Os11g27760.1 | synonymous_variant ; p.Tyr384Tyr; LOW | synonymous_codon | Average:10.492; most accessible tissue: Callus, score: 28.482 | N | N | N | N |
| vg1115981616 | C -> DEL | LOC_Os11g27760.1 | N | frameshift_variant | Average:10.492; most accessible tissue: Callus, score: 28.482 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1115981616 | 3.02E-06 | NA | mr1151_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115981616 | NA | 5.82E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115981616 | NA | 3.71E-11 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115981616 | NA | 4.71E-08 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115981616 | NA | 8.43E-07 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115981616 | NA | 4.96E-08 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115981616 | NA | 1.15E-07 | mr1837_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115981616 | NA | 8.64E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115981616 | NA | 2.26E-06 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |