Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115971998:

Variant ID: vg1115971998 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 15971998
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAAAGATTAAAGCAACCTTCGGAAAAAGATTAGATCATATTTGGTACATATATTAAAAAGGAATAATATGTCATTGAAAAGAGAGAACGGATTTATATC[A/G]
ATTTTGAACGGCTAAGATTAATCTTGCAAGCGAACCTCACGAGATACCGACTCAACGAGTCAATTCTACGTGACACGGGATCACCCAAATGATCAACCAA

Reverse complement sequence

TTGGTTGATCATTTGGGTGATCCCGTGTCACGTAGAATTGACTCGTTGAGTCGGTATCTCGTGAGGTTCGCTTGCAAGATTAATCTTAGCCGTTCAAAAT[T/C]
GATATAAATCCGTTCTCTCTTTTCAATGACATATTATTCCTTTTTAATATATGTACCAAATATGATCTAATCTTTTTCCGAAGGTTGCTTTAATCTTTTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.70%	0.50%	15.85%	27.93%	NA
All Indica	2759	33.20%	0.80%	23.41%	42.52%	NA
All Japonica	1512	97.40%	0.00%	0.53%	2.05%	NA
Aus	269	38.70%	0.00%	31.97%	29.37%	NA
Indica I	595	35.30%	0.20%	9.58%	54.96%	NA
Indica II	465	16.80%	0.00%	26.88%	56.34%	NA
Indica III	913	40.40%	2.20%	32.09%	25.30%	NA
Indica Intermediate	786	33.10%	0.30%	21.76%	44.91%	NA
Temperate Japonica	767	97.10%	0.00%	0.13%	2.74%	NA
Tropical Japonica	504	97.20%	0.00%	1.39%	1.39%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	94.80%	0.00%	1.04%	4.17%	NA
Intermediate	90	54.40%	0.00%	8.89%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1115971998	A -> DEL	N	N	silent_mutation	Average:10.185; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg1115971998	A -> G	LOC_Os11g27740.1	downstream_gene_variant ; 1561.0bp to feature; MODIFIER	silent_mutation	Average:10.185; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg1115971998	A -> G	LOC_Os11g27750.1	downstream_gene_variant ; 4402.0bp to feature; MODIFIER	silent_mutation	Average:10.185; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg1115971998	A -> G	LOC_Os11g27740-LOC_Os11g27750	intergenic_region ; MODIFIER	silent_mutation	Average:10.185; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1115971998	8.14E-06	NA	mr1098	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115971998	4.31E-06	NA	mr1099	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115971998	3.58E-07	3.58E-07	mr1329	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115971998	NA	2.68E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115971998	NA	8.67E-89	mr1758	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115971998	NA	1.31E-07	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251