| Variant ID: vg1115971998 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 15971998 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TAAAAGATTAAAGCAACCTTCGGAAAAAGATTAGATCATATTTGGTACATATATTAAAAAGGAATAATATGTCATTGAAAAGAGAGAACGGATTTATATC[A/G]
ATTTTGAACGGCTAAGATTAATCTTGCAAGCGAACCTCACGAGATACCGACTCAACGAGTCAATTCTACGTGACACGGGATCACCCAAATGATCAACCAA
TTGGTTGATCATTTGGGTGATCCCGTGTCACGTAGAATTGACTCGTTGAGTCGGTATCTCGTGAGGTTCGCTTGCAAGATTAATCTTAGCCGTTCAAAAT[T/C]
GATATAAATCCGTTCTCTCTTTTCAATGACATATTATTCCTTTTTAATATATGTACCAAATATGATCTAATCTTTTTCCGAAGGTTGCTTTAATCTTTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.70% | 0.50% | 15.85% | 27.93% | NA |
| All Indica | 2759 | 33.20% | 0.80% | 23.41% | 42.52% | NA |
| All Japonica | 1512 | 97.40% | 0.00% | 0.53% | 2.05% | NA |
| Aus | 269 | 38.70% | 0.00% | 31.97% | 29.37% | NA |
| Indica I | 595 | 35.30% | 0.20% | 9.58% | 54.96% | NA |
| Indica II | 465 | 16.80% | 0.00% | 26.88% | 56.34% | NA |
| Indica III | 913 | 40.40% | 2.20% | 32.09% | 25.30% | NA |
| Indica Intermediate | 786 | 33.10% | 0.30% | 21.76% | 44.91% | NA |
| Temperate Japonica | 767 | 97.10% | 0.00% | 0.13% | 2.74% | NA |
| Tropical Japonica | 504 | 97.20% | 0.00% | 1.39% | 1.39% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 54.40% | 0.00% | 8.89% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1115971998 | A -> DEL | N | N | silent_mutation | Average:10.185; most accessible tissue: Minghui63 root, score: 23.574 | N | N | N | N |
| vg1115971998 | A -> G | LOC_Os11g27740.1 | downstream_gene_variant ; 1561.0bp to feature; MODIFIER | silent_mutation | Average:10.185; most accessible tissue: Minghui63 root, score: 23.574 | N | N | N | N |
| vg1115971998 | A -> G | LOC_Os11g27750.1 | downstream_gene_variant ; 4402.0bp to feature; MODIFIER | silent_mutation | Average:10.185; most accessible tissue: Minghui63 root, score: 23.574 | N | N | N | N |
| vg1115971998 | A -> G | LOC_Os11g27740-LOC_Os11g27750 | intergenic_region ; MODIFIER | silent_mutation | Average:10.185; most accessible tissue: Minghui63 root, score: 23.574 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1115971998 | 8.14E-06 | NA | mr1098 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115971998 | 4.31E-06 | NA | mr1099 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115971998 | 3.58E-07 | 3.58E-07 | mr1329 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115971998 | NA | 2.68E-09 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115971998 | NA | 8.67E-89 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115971998 | NA | 1.31E-07 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |