Variant ID: vg1115925850 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 15925850 |
Reference Allele: A | Alternative Allele: T |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCAAAGCAAATCCAAAAGCAAAAGAAGACTCAACATTTTTGGTTGTTTCACTCACATATTCCAATGTCAAGCAATTAGCAAAATTGACGTCTTACAAAAC[A/T]
GTAATTTTAGAAAATAAAACTCCACAAGATTTACAATCATCATCATTAGGGTCCATAGATTTTAATCTATCAATTTCAGCTTTTAGAATTTCAATAGTGT
ACACTATTGAAATTCTAAAAGCTGAAATTGATAGATTAAAATCTATGGACCCTAATGATGATGATTGTAAATCTTGTGGAGTTTTATTTTCTAAAATTAC[T/A]
GTTTTGTAAGACGTCAATTTTGCTAATTGCTTGACATTGGAATATGTGAGTGAAACAACCAAAAATGTTGAGTCTTCTTTTGCTTTTGGATTTGCTTTGC
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 93.30% | 5.90% | 0.78% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 79.70% | 18.00% | 2.31% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 99.00% | 0.30% | 0.78% | 0.00% | NA |
Tropical Japonica | 504 | 44.00% | 50.60% | 5.36% | 0.00% | NA |
Japonica Intermediate | 241 | 92.90% | 6.20% | 0.83% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1115925850 | A -> T | LOC_Os11g27650.1 | downstream_gene_variant ; 1717.0bp to feature; MODIFIER | silent_mutation | Average:21.509; most accessible tissue: Zhenshan97 young leaf, score: 28.885 | N | N | N | N |
vg1115925850 | A -> T | LOC_Os11g27660.1 | downstream_gene_variant ; 2016.0bp to feature; MODIFIER | silent_mutation | Average:21.509; most accessible tissue: Zhenshan97 young leaf, score: 28.885 | N | N | N | N |
vg1115925850 | A -> T | LOC_Os11g27650-LOC_Os11g27660 | intergenic_region ; MODIFIER | silent_mutation | Average:21.509; most accessible tissue: Zhenshan97 young leaf, score: 28.885 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1115925850 | NA | 3.70E-11 | mr1235 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115925850 | NA | 8.70E-07 | mr1243 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115925850 | NA | 1.63E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115925850 | NA | 1.72E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115925850 | NA | 4.74E-07 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115925850 | NA | 8.32E-06 | mr1502 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115925850 | NA | 1.40E-11 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115925850 | NA | 1.43E-10 | mr1539 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115925850 | NA | 4.53E-08 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115925850 | NA | 1.03E-06 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/