RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1115925850:

Variant ID: vg1115925850 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 15925850
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCAAAGCAAATCCAAAAGCAAAAGAAGACTCAACATTTTTGGTTGTTTCACTCACATATTCCAATGTCAAGCAATTAGCAAAATTGACGTCTTACAAAAC[A/T]
GTAATTTTAGAAAATAAAACTCCACAAGATTTACAATCATCATCATTAGGGTCCATAGATTTTAATCTATCAATTTCAGCTTTTAGAATTTCAATAGTGT

Reverse complement sequence

ACACTATTGAAATTCTAAAAGCTGAAATTGATAGATTAAAATCTATGGACCCTAATGATGATGATTGTAAATCTTGTGGAGTTTTATTTTCTAAAATTAC[T/A]
GTTTTGTAAGACGTCAATTTTGCTAATTGCTTGACATTGGAATATGTGAGTGAAACAACCAAAAATGTTGAGTCTTCTTTTGCTTTTGGATTTGCTTTGC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.30%	5.90%	0.78%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.04%	0.00%	NA
All Japonica	1512	79.70%	18.00%	2.31%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.00%	0.13%	0.00%	NA
Temperate Japonica	767	99.00%	0.30%	0.78%	0.00%	NA
Tropical Japonica	504	44.00%	50.60%	5.36%	0.00%	NA
Japonica Intermediate	241	92.90%	6.20%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	7.80%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1115925850	A -> T	LOC_Os11g27650.1	downstream_gene_variant ; 1717.0bp to feature; MODIFIER	silent_mutation	Average:21.509; most accessible tissue: Zhenshan97 young leaf, score: 28.885	N	N	N	N
vg1115925850	A -> T	LOC_Os11g27660.1	downstream_gene_variant ; 2016.0bp to feature; MODIFIER	silent_mutation	Average:21.509; most accessible tissue: Zhenshan97 young leaf, score: 28.885	N	N	N	N
vg1115925850	A -> T	LOC_Os11g27650-LOC_Os11g27660	intergenic_region ; MODIFIER	silent_mutation	Average:21.509; most accessible tissue: Zhenshan97 young leaf, score: 28.885	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1115925850	NA	3.70E-11	mr1235	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115925850	NA	8.70E-07	mr1243	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115925850	NA	1.63E-06	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115925850	NA	1.72E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115925850	NA	4.74E-07	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115925850	NA	8.32E-06	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115925850	NA	1.40E-11	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115925850	NA	1.43E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115925850	NA	4.53E-08	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115925850	NA	1.03E-06	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 61 entries

Previous1 2 3 4 5 6 7Next

Search for Variation information by Variation ID:

Detailed information for vg1115925850:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact