Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115917664:

Variant ID: vg1115917664 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 15917664
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

TAGGTGAAACCCTACGCATTATTGTGGGAATTTAGTATGATAATAATTAAAAAAAATAACGTGTAAGATAGCTAGATAATATCAGATTAAGTAAATTAAT[A/G]
TGGTTTATGATAATTTAAATTTAAATAGTATGTAGAATGGTGATTCAAACGTAAAAAGTAAGGTGCTATGACTTTATGGAAGAAGAAAAGTAGGGAGATA

Reverse complement sequence

TATCTCCCTACTTTTCTTCTTCCATAAAGTCATAGCACCTTACTTTTTACGTTTGAATCACCATTCTACATACTATTTAAATTTAAATTATCATAAACCA[T/C]
ATTAATTTACTTAATCTGATATTATCTAGCTATCTTACACGTTATTTTTTTTAATTATTATCATACTAAATTCCCACAATAATGCGTAGGGTTTCACCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.60%	36.10%	0.32%	0.00%	NA
All Indica	2759	68.70%	31.00%	0.29%	0.00%	NA
All Japonica	1512	46.40%	53.20%	0.40%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	84.70%	15.10%	0.17%	0.00%	NA
Indica II	465	39.40%	60.40%	0.22%	0.00%	NA
Indica III	913	77.90%	21.70%	0.44%	0.00%	NA
Indica Intermediate	786	63.40%	36.40%	0.25%	0.00%	NA
Temperate Japonica	767	27.90%	71.40%	0.65%	0.00%	NA
Tropical Japonica	504	75.20%	24.60%	0.20%	0.00%	NA
Japonica Intermediate	241	44.80%	55.20%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	53.30%	45.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1115917664	A -> G	LOC_Os11g27650.1	upstream_gene_variant ; 2561.0bp to feature; MODIFIER	silent_mutation	Average:33.956; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1115917664	A -> G	LOC_Os11g27640.1	downstream_gene_variant ; 2601.0bp to feature; MODIFIER	silent_mutation	Average:33.956; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1115917664	A -> G	LOC_Os11g27640-LOC_Os11g27650	intergenic_region ; MODIFIER	silent_mutation	Average:33.956; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1115917664	NA	1.71E-06	mr1758	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115917664	NA	2.61E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115917664	NA	2.89E-06	mr1154_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115917664	NA	1.55E-06	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115917664	NA	3.53E-07	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115917664	NA	4.18E-06	mr1500_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115917664	1.11E-06	1.58E-14	mr1758_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115917664	NA	4.35E-09	mr1829_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251