\
| Variant ID: vg1115917664 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 15917664 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 92. )
TAGGTGAAACCCTACGCATTATTGTGGGAATTTAGTATGATAATAATTAAAAAAAATAACGTGTAAGATAGCTAGATAATATCAGATTAAGTAAATTAAT[A/G]
TGGTTTATGATAATTTAAATTTAAATAGTATGTAGAATGGTGATTCAAACGTAAAAAGTAAGGTGCTATGACTTTATGGAAGAAGAAAAGTAGGGAGATA
TATCTCCCTACTTTTCTTCTTCCATAAAGTCATAGCACCTTACTTTTTACGTTTGAATCACCATTCTACATACTATTTAAATTTAAATTATCATAAACCA[T/C]
ATTAATTTACTTAATCTGATATTATCTAGCTATCTTACACGTTATTTTTTTTAATTATTATCATACTAAATTCCCACAATAATGCGTAGGGTTTCACCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.60% | 36.10% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 68.70% | 31.00% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 46.40% | 53.20% | 0.40% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.70% | 15.10% | 0.17% | 0.00% | NA |
| Indica II | 465 | 39.40% | 60.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 77.90% | 21.70% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 63.40% | 36.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 27.90% | 71.40% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 75.20% | 24.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 44.80% | 55.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 45.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1115917664 | A -> G | LOC_Os11g27650.1 | upstream_gene_variant ; 2561.0bp to feature; MODIFIER | silent_mutation | Average:33.956; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg1115917664 | A -> G | LOC_Os11g27640.1 | downstream_gene_variant ; 2601.0bp to feature; MODIFIER | silent_mutation | Average:33.956; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg1115917664 | A -> G | LOC_Os11g27640-LOC_Os11g27650 | intergenic_region ; MODIFIER | silent_mutation | Average:33.956; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1115917664 | NA | 1.71E-06 | mr1758 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115917664 | NA | 2.61E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115917664 | NA | 2.89E-06 | mr1154_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115917664 | NA | 1.55E-06 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115917664 | NA | 3.53E-07 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115917664 | NA | 4.18E-06 | mr1500_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115917664 | 1.11E-06 | 1.58E-14 | mr1758_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115917664 | NA | 4.35E-09 | mr1829_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |