\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115917664:

Variant ID: vg1115917664 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 15917664
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TAGGTGAAACCCTACGCATTATTGTGGGAATTTAGTATGATAATAATTAAAAAAAATAACGTGTAAGATAGCTAGATAATATCAGATTAAGTAAATTAAT[A/G]
TGGTTTATGATAATTTAAATTTAAATAGTATGTAGAATGGTGATTCAAACGTAAAAAGTAAGGTGCTATGACTTTATGGAAGAAGAAAAGTAGGGAGATA

Reverse complement sequence

TATCTCCCTACTTTTCTTCTTCCATAAAGTCATAGCACCTTACTTTTTACGTTTGAATCACCATTCTACATACTATTTAAATTTAAATTATCATAAACCA[T/C]
ATTAATTTACTTAATCTGATATTATCTAGCTATCTTACACGTTATTTTTTTTAATTATTATCATACTAAATTCCCACAATAATGCGTAGGGTTTCACCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.60% 36.10% 0.32% 0.00% NA
All Indica  2759 68.70% 31.00% 0.29% 0.00% NA
All Japonica  1512 46.40% 53.20% 0.40% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 84.70% 15.10% 0.17% 0.00% NA
Indica II  465 39.40% 60.40% 0.22% 0.00% NA
Indica III  913 77.90% 21.70% 0.44% 0.00% NA
Indica Intermediate  786 63.40% 36.40% 0.25% 0.00% NA
Temperate Japonica  767 27.90% 71.40% 0.65% 0.00% NA
Tropical Japonica  504 75.20% 24.60% 0.20% 0.00% NA
Japonica Intermediate  241 44.80% 55.20% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 53.30% 45.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1115917664 A -> G LOC_Os11g27650.1 upstream_gene_variant ; 2561.0bp to feature; MODIFIER silent_mutation Average:33.956; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1115917664 A -> G LOC_Os11g27640.1 downstream_gene_variant ; 2601.0bp to feature; MODIFIER silent_mutation Average:33.956; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1115917664 A -> G LOC_Os11g27640-LOC_Os11g27650 intergenic_region ; MODIFIER silent_mutation Average:33.956; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1115917664 NA 1.71E-06 mr1758 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115917664 NA 2.61E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115917664 NA 2.89E-06 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115917664 NA 1.55E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115917664 NA 3.53E-07 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115917664 NA 4.18E-06 mr1500_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115917664 1.11E-06 1.58E-14 mr1758_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115917664 NA 4.35E-09 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251