Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115880965:

Variant ID: vg1115880965 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 15880965
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.01, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

AAGAATATCAAATAGAAATAGCCCCTAAGCGAACGCTCAAAGGGTGACAATGTTATAATATGTATGGTAAATTGAAAATGAATTAAATTTACCGACCAAT[G/C]
TTTTGTGTATGAGCGTCTTCTCTCTTACCGACTTCGATCAGTCAGTTTATAGAGTCATACACTCTCCCTAGCCCCCAACCTTGTCGTCGGAGAATTGTTC

Reverse complement sequence

GAACAATTCTCCGACGACAAGGTTGGGGGCTAGGGAGAGTGTATGACTCTATAAACTGACTGATCGAAGTCGGTAAGAGAGAAGACGCTCATACACAAAA[C/G]
ATTGGTCGGTAAATTTAATTCATTTTCAATTTACCATACATATTATAACATTGTCACCCTTTGAGCGTTCGCTTAGGGGCTATTTCTATTTGATATTCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.70%	43.30%	1.04%	0.00%	NA
All Indica	2759	32.20%	66.10%	1.70%	0.00%	NA
All Japonica	1512	98.10%	1.90%	0.00%	0.00%	NA
Aus	269	41.60%	58.40%	0.00%	0.00%	NA
Indica I	595	15.30%	83.70%	1.01%	0.00%	NA
Indica II	465	60.90%	37.20%	1.94%	0.00%	NA
Indica III	913	23.10%	75.20%	1.64%	0.00%	NA
Indica Intermediate	786	38.50%	59.30%	2.16%	0.00%	NA
Temperate Japonica	767	99.00%	1.00%	0.00%	0.00%	NA
Tropical Japonica	504	96.80%	3.20%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	65.60%	32.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1115880965	G -> C	LOC_Os11g27580.1	upstream_gene_variant ; 2090.0bp to feature; MODIFIER	silent_mutation	Average:24.895; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1115880965	G -> C	LOC_Os11g27570.1	downstream_gene_variant ; 157.0bp to feature; MODIFIER	silent_mutation	Average:24.895; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1115880965	G -> C	LOC_Os11g27570-LOC_Os11g27580	intergenic_region ; MODIFIER	silent_mutation	Average:24.895; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1115880965	NA	1.63E-06	mr1758	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	5.12E-07	mr1921	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	3.92E-08	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	5.40E-08	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	2.05E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	6.80E-08	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	6.20E-07	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	3.74E-06	mr1500_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	1.08E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	2.79E-06	mr1641_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	3.13E-06	mr1696_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	1.45E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	3.75E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	2.00E-11	mr1758_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	1.56E-06	mr1759_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	1.33E-07	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	1.25E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	9.62E-10	mr1829_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	9.42E-09	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	2.58E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	1.66E-06	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	2.18E-06	mr1854_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	6.96E-07	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	5.60E-06	mr1876_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	2.24E-06	mr1901_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115880965	NA	1.03E-07	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251