\
| Variant ID: vg1115875261 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 15875261 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )
TAAATTCCAAAAACTACACAGTGTTAAATATCCTGCTATATATTTTTTAATAAGGGATTAAAACCTGGCCTCTAGATCTATAATCAATATGTACACGGCC[G/A]
AGGAACGACCAAGTATACTACTAGTTCCAACTTCCAAATAAAATAGAGATTGTGTTGAAGGTTGTTGACATATTTTGGAGTTGTACTATTCTTCATTCTT
AAGAATGAAGAATAGTACAACTCCAAAATATGTCAACAACCTTCAACACAATCTCTATTTTATTTGGAAGTTGGAACTAGTAGTATACTTGGTCGTTCCT[C/T]
GGCCGTGTACATATTGATTATAGATCTAGAGGCCAGGTTTTAATCCCTTATTAAAAAATATATAGCAGGATATTTAACACTGTGTAGTTTTTGGAATTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.70% | 16.30% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 56.40% | 43.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 75.60% | 24.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 28.80% | 71.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 53.10% | 46.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1115875261 | G -> A | LOC_Os11g27570.1 | upstream_gene_variant ; 874.0bp to feature; MODIFIER | silent_mutation | Average:64.426; most accessible tissue: Minghui63 root, score: 88.891 | N | N | N | N |
| vg1115875261 | G -> A | LOC_Os11g27560-LOC_Os11g27570 | intergenic_region ; MODIFIER | silent_mutation | Average:64.426; most accessible tissue: Minghui63 root, score: 88.891 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1115875261 | NA | 1.49E-10 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1115875261 | NA | 9.37E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115875261 | NA | 5.56E-07 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115875261 | NA | 1.33E-08 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115875261 | NA | 4.98E-06 | mr1133_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115875261 | NA | 6.50E-06 | mr1566_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115875261 | NA | 1.84E-06 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115875261 | NA | 7.16E-06 | mr1667_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115875261 | NA | 2.88E-09 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |