\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115875261:

Variant ID: vg1115875261 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 15875261
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


TAAATTCCAAAAACTACACAGTGTTAAATATCCTGCTATATATTTTTTAATAAGGGATTAAAACCTGGCCTCTAGATCTATAATCAATATGTACACGGCC[G/A]
AGGAACGACCAAGTATACTACTAGTTCCAACTTCCAAATAAAATAGAGATTGTGTTGAAGGTTGTTGACATATTTTGGAGTTGTACTATTCTTCATTCTT

Reverse complement sequence

AAGAATGAAGAATAGTACAACTCCAAAATATGTCAACAACCTTCAACACAATCTCTATTTTATTTGGAAGTTGGAACTAGTAGTATACTTGGTCGTTCCT[C/T]
GGCCGTGTACATATTGATTATAGATCTAGAGGCCAGGTTTTAATCCCTTATTAAAAAATATATAGCAGGATATTTAACACTGTGTAGTTTTTGGAATTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.70% 16.30% 0.04% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 56.40% 43.50% 0.13% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 75.60% 24.30% 0.13% 0.00% NA
Tropical Japonica  504 28.80% 71.20% 0.00% 0.00% NA
Japonica Intermediate  241 53.10% 46.50% 0.41% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1115875261 G -> A LOC_Os11g27570.1 upstream_gene_variant ; 874.0bp to feature; MODIFIER silent_mutation Average:64.426; most accessible tissue: Minghui63 root, score: 88.891 N N N N
vg1115875261 G -> A LOC_Os11g27560-LOC_Os11g27570 intergenic_region ; MODIFIER silent_mutation Average:64.426; most accessible tissue: Minghui63 root, score: 88.891 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1115875261 NA 1.49E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1115875261 NA 9.37E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115875261 NA 5.56E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115875261 NA 1.33E-08 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115875261 NA 4.98E-06 mr1133_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115875261 NA 6.50E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115875261 NA 1.84E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115875261 NA 7.16E-06 mr1667_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115875261 NA 2.88E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251