Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115875261:

Variant ID: vg1115875261 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 15875261
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

TAAATTCCAAAAACTACACAGTGTTAAATATCCTGCTATATATTTTTTAATAAGGGATTAAAACCTGGCCTCTAGATCTATAATCAATATGTACACGGCC[G/A]
AGGAACGACCAAGTATACTACTAGTTCCAACTTCCAAATAAAATAGAGATTGTGTTGAAGGTTGTTGACATATTTTGGAGTTGTACTATTCTTCATTCTT

Reverse complement sequence

AAGAATGAAGAATAGTACAACTCCAAAATATGTCAACAACCTTCAACACAATCTCTATTTTATTTGGAAGTTGGAACTAGTAGTATACTTGGTCGTTCCT[C/T]
GGCCGTGTACATATTGATTATAGATCTAGAGGCCAGGTTTTAATCCCTTATTAAAAAATATATAGCAGGATATTTAACACTGTGTAGTTTTTGGAATTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.70%	16.30%	0.04%	0.00%	NA
All Indica	2759	99.80%	0.20%	0.00%	0.00%	NA
All Japonica	1512	56.40%	43.50%	0.13%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	75.60%	24.30%	0.13%	0.00%	NA
Tropical Japonica	504	28.80%	71.20%	0.00%	0.00%	NA
Japonica Intermediate	241	53.10%	46.50%	0.41%	0.00%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1115875261	G -> A	LOC_Os11g27570.1	upstream_gene_variant ; 874.0bp to feature; MODIFIER	silent_mutation	Average:64.426; most accessible tissue: Minghui63 root, score: 88.891	N	N	N	N
vg1115875261	G -> A	LOC_Os11g27560-LOC_Os11g27570	intergenic_region ; MODIFIER	silent_mutation	Average:64.426; most accessible tissue: Minghui63 root, score: 88.891	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1115875261	NA	1.49E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1115875261	NA	9.37E-11	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115875261	NA	5.56E-07	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115875261	NA	1.33E-08	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115875261	NA	4.98E-06	mr1133_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115875261	NA	6.50E-06	mr1566_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115875261	NA	1.84E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115875261	NA	7.16E-06	mr1667_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115875261	NA	2.88E-09	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251